Which statement best describes translation?00The process converts an mRNA sequence into a polypeptide.It uses ribosomes to make mRNA.It produces Okazaki fragments.It produces RNA from DNA moleculesThe process breaks bonds between amino acids. Match the location in a cell in the first column with the process in column two.carbon dioxide is used inthe Calvin cycle in carbonfixationwhere oxidative000phosphorylation occurs inanimal cellscarbon dioxide is producedin cellular respirationoxygen is released viaphotolysis1.2.3.P680 in ThylakoidStroma of ChloroplastMatrix of Mitochondrion4. Cristae and Intermembrane space

Name: Which statement best describes translation?00The process converts an
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Which statement best describes translation?00The process converts an mRNA sequence into a polypeptide.It uses ribosomes to make mRNA.It produces Okazaki fragments.It produces RNA from DNA moleculesThe process breaks bonds between amino acids. Match

The central dogma of molecular biology is a fundamental principle that describes the flow of genetic…

Science

Biology

Which statement best describes translation? The process converts an mRNA sequence into a polypeptide. It uses ribosomes to make mRNA. It produces Okazaki fragments. It produces RNA from DNA molecules The process breaks bonds between amino acids.

Which statement best describes translation? The process converts an mRNA sequence into a polypeptide. It uses ribosomes to make mRNA. It produces Okazaki fragments. It produces RNA from DNA molecules The process breaks bonds between amino acids.

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter13: Gene Expression

Section13.4: Translation

Problem 3C: A certain mRNA strand has the following nucleotide sequence: 5AUGACGUAUAACUUU3 What is the anticodon...

See similar textbooks

Similar questions

A certain mRNA strand has the following nucleotide sequence: 5AUGACGUAUAACUUU3 What is the anticodon for each codon? What is the amino acid sequence of the polypeptide? (Use Figure 13-5 to help answer this question.) Figure 13-5 The genetic code The genetic code specifies all possible combinations of the three bases that compose codons in mRNA. Of the 64 possible codons, 61 specify amino acids (see Figure 3-17 for an explanation of abbreviations). The codon AUG specifies the amino acid methionine and also signals the ribosome to initiate translation (start). Three codonsUAA, UGA, and UAGdo not specify amino acids; they terminate polypeptide synthesis (stop).
The end result of BOTH transcription and translation of the DNA sequence AAGCTGGGA would result in? Oan MRNA strand with the sequence TTCGACCCT Oan MRNA strand with the sequence UUCGACCCU a sequence of three amino acids linked by peptide bonds Oa carbohydrate in the form of a polysaccharide
Flag question: Question 4' DNA- Coding Strand DNA-Template Strand mRNA Protein TGC ↓ ↓ ↓ ↓ ↓ ↓ Met t CCA Trp ↓ ↓ UAA ↓
DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ From the given DNA sequence above, change one base in codon 8 to show same sense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 8 Add an A before codon 3 or delete the middle base in codon 3 to show the shift of reading frame to:a. the rightDNA:mRNA:polypeptide chain:b. the leftDNA:mRNA:polypeptide chain:
Below are the steps of protein synthesis. What is the correct sequential order? 1. MRNA is formed with codons as product of transcription. 2. Codons are translated and polypeptide chain is transferred. 3. mRNA moves into cytoplasm and becomes associated with ribosomes. 4. DNA in nucleus serves as a template. 5. Anticodon - codon complementary base pairing occurs with tRNA and MRNA. * 4, 1, 3, 2, 5 4, 3, 1, 5, 2 O 4, 1, 2, 3, 5 O 4, 1, 3, 5, 2
Which of the following statements concerning translation is NOT correct? O b. O c. Polypeptide chain is extended from the C- terminus to the N-terminus. O d. The first codon of protein synthesis is AUG. Prokaryotic transcription and translation are coupled (i.e. they occur almost at the same time and at the same place). O e. Protein synthesis takes place in ribosome. During protein synthesis, the mRNA is read from 5' to 3' direction.
Which three codons would code for a different amino acid sequence from that coded for by the mRNA base sequence AGU-UCA-CCA? O AGU-UCC-CCG O AGU-UCG-CCC O AGC-UCA-CCU O AGC-UCU-CCU
Put the following steps of protein synthesis in order: STEP A - Anticodon attaches to the mRNA STEP B - mRNA leave the nucleus and attaches to a ribosome STEP C - complementary mRNA attaches to DNA STEP D - the amino acids bond, forming a protein C, B, A, D O A, C, B, D O D, C, A, B O B, C, A, D
If a scientist synthesizes a DNA molecule with a nucleotide base sequence to TACGGGGGAGGGGGAGGGGGA transcription and translation what would be the amino acid sequence of the product?
(6C) The diagram below shows the process of translation. protein moleçule forming Bead and re-read ibosome Underline 3 key words Bracket the Question Brain Dump everything you know Eliminate 2 wrong answers Select an answer Which of the following describes the role of the ribosome? Answer carries amino acids to the ribosome directs the order of monosaccharides in a protein attaches amino acids to each other to make a protein acts as a catalyst in controlling chemical reactions Previous achnologies Inc2021 Edugence edugence com/student/studentformative/# RARO
A thymine is changed to an adenine in one DNA codon which causes a particular disorder. Which statement explains how the change in the DNA codon leads to this disorder? * O The frameshift mutation stops the production of a protein in the organism. O The substitution causes a different protein to be produced in the organism. O The insertion mutation caused the production of extra protein inthe organism. The deletion mutation prevents the production of an important protein in the organism. Which type of mutations are the least harmful to an organism? * O Duplication Substitution Insertion
A sequence of MRNA is mutated such that there is no "start" codon. Which of the following is a consequence? O No peptide chain gets built O RNA polymerase is halted O The gene gets copied in an infinite loop O The ribosome can no longer bind