Which statement about RNA is false? A, Transfer RNA functions in translation. B, DNA codes for mRNA, tRNA, and rRNA. C, Ribosomal RNA functions in translation. D, RNAs are produced by transcription. E, Messenger RNAs are produced by ribosomes.

Which statement about RNA is false? A, Transfer RNA functions in translation. B, DNA codes for mRNA, tRNA, and rRNA. C, Ribosomal RNA functions in translation. D, RNAs are produced by transcription. E, Messenger RNAs are produced by ribosomes.

Name: Question 1? Question 1Which statement about RNA is false?A, Transfer R
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Question 1? Question 1Which statement about RNA is false?A, Transfer RNA functions in translation.B, DNA codes for mRNA, tRNA, and rRNA.C, Ribosomal RNA functions in translation.D, RNAs are produced by transcription.E, Messenger RNAs are produced byr

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter4: Cells

Section: Chapter Questions

Problem 2TYK: Eukaryotic and prokaryotic ribosomes are similar in that: a. both contain a small subunit, but only...

See similar textbooks

Similar questions

15. which does not play a role in translation? Ribosomes mRNA tRNA amino acids DNA
Eukaryotic and prokaryotic ribosomes are similar in that: a. both contain a small subunit, but only eukaryotes contain a large subunit. b. both contain the same number of proteins. c. both use mRNA to assemble amino acids into proteins. d. both contain the same number of types of rRNA. e. both produce proteins that can pass through pores into the nucleus.
ture.com/courses/132776/quizzes/489888/take O Ribosome Question 22 22. During transcription, what does messenger RNA do? O It strings together two complementary RNA strands O It strings together two complementary DNA strands O It constructS proteins out of random amino acids O It delivers DNA's Instructions for making proteins Question 23
1. Create a DNA sequence with eighteen nucleotides. Indicate its 3’ on the left and 5’ on the right since that’s the template strand you will need in the next question to transcribe the mRNA. 2. Transcribe the DNA sequence above and separate the triplets into codons. Indicate 5’ and 3’ in the correct location on the strand. (Don’t worry about splicing- assume that the pre- mRNA is the same as the mature mRNA sequence) 3. Look at the genetic code, and indicate which amino acid is coded for by the codons in the above mRNA. 4. ANSWER BELOW QUESTIONS: A. First write the original DNA strand. Indicate where the substitution was by either circling it or writing it in a different color. Then write the mutated DNA sequence with the point mutation (aka substitution) wherever you choose for it to be. Again, circle it or write it in a different color. Do the same for the transcribed mRNA. Repeat the directions for 2 and 3 for this new DNA stand. (i.e., include the mRNA and translated protein…
8. Below is a double stranded DNA: ATATGTGGTCTCGG TCCGTTAGGCAAT TATACACCAGAGCCAGGCAATCCGTTA 8.1. Which strand functions as the transcription template, the top one or the bottom one? Explain your reasoning What is the MRNA transcript and polypeptide from this strand? In the space below, copy the DNA strand that is transcribed, and write the MRNA transcript. 8.2. 8.3. Identify the polypeptide chain below it. Align the MRNA and polypeptide so that it is clear which DNA bases they came from.
DNA 11. A A A U C MRNA 12. 13. TRNA Amino Acids 14. Aзparagine 15. lor 3 codonas equal one aminoacid? 16. RNA brings amino acids to the nucleus orribosome? 17. A polypeptide is a sequence of proteins or aminoacid:? 18. RNA has codons or anti-codons? 19. RNA transfers amino acids during trauslationbetranscrintion? 20. Ribosomes are the site where translationor transcription takesplace? DNA 21. © A T 22. (A G MRNA 23. ERNA Amino Acids 24. Stop FOo -0- FO- -0- Foo- FOo- Fo- FO-
S # 3 Question Here is the sequence of an mRNA molecule: GUC/GGG/CUC/AGA/GAA What is the protein sequence that would be made from this mRNA sequence? The slash marks ("/") shown in the above sequence are so that you can read the sequence easier. The slash marks that are shown between the blanks below are to help you keep your place in the protein sequence. Use the genetic code below to help answer this question. ***Only use the 3-letter code for each amino acid (for example, Phe or Leu) for your answers, or else they will be marked wrong!*** first base U G 80 F3 31 UUU UUC UUA UUG U CUU CUC CUA CUG AUU AUC ile AUA AUG met (start) GUU GUC GUA GUG $ 4 phe leu leu val 000 F4 UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG O LO % 5 с second base ser 24 F5 pro thr ala A UAC tyr UAA Stop UAG Stop CAC his CAA 1 CAG gln AAU AAC J AAA AAG lys asn GAU 1 GAC Jasp GAA 1 GAG glu S MacBook Air F6 G UGC} cys UGA Stop UGG trp & CGU CGC CGA CGG AGU AGC AGA 1 AGG GGU GGC GGA GGG AA F7 11…
What property of nucleic acids do Phil Sharp's experiments take advantage of? What type of structure would you expect if a processed mRNA is hybridized to its DNA gene sequence? What about if you hybridize a pre-MRNA to its DNA gene sequence? 35
Which of the following statement about mRNA is TRUE? Question 12 options: mRNA splicing is a conserved process in both prokaryotes and eukaryotes. Post-transcriptional regulation of gene expression may occur outside of the nucleus in eukaryotes. In eukaryotes, mRNA maturation requires 5'-capping, splicing and the addition of poly A tails. mRNA is transported out of the nucleus for translation in eukarytotes.
The end result of BOTH transcription and translation of the DNA sequence AAGCTGGGA would result in? Oan MRNA strand with the sequence TTCGACCCT Oan MRNA strand with the sequence UUCGACCCU a sequence of three amino acids linked by peptide bonds Oa carbohydrate in the form of a polysaccharide
After viewing https://www.youtube.com/watch?v=qIwrhUrvX-k , relate the structure of the three RNA to their function in building of Polypeptide and point out the characteristics of a genetic code and their function in translation. 1. Messenger RNA 2. Transfer RNA 3. Ribosomal RNA
Question 1: The c-myc gene has several exons. What are the stages of the maturation process that its main transcript must undergo before becoming a mature mRNA Question 2: In which cell compartment does mRNA maturation take place?