Q: Based on the structures of some polysaccharides studied, which of the following is its main function...
A: Carbohydrate are the biological macromolecules which consists of elements like carbon , hydrogen as ...
Q: Create a Venn Diagram to show the relatedness of these organisms. Start with the trait that is share...
A: Venn diagram used to construct to find similarities or difference in traits of the organisms. The sq...
Q: 4. If you drink a lot of water, you may produce large amounts of urine that has a light yellow color...
A: Introduction: Water is an extremely valuable natural resource. Water is required for the survival of...
Q: Which of the following represents an example of a proteoglycan? attachment of several molecules of h...
A: Proteoglycans can be defined as the heavily glycosylated proteins (high molecular weight) found in t...
Q: Salmonella strains developed for the Ames test contain many special phenotypes that make them more u...
A: The majority of the chemicals are not mutagenic or carcinogenic, but they can be converted into muta...
Q: what are two advantages and disadvantages of electron microscopes?
A: Introduction: An electron microscope is a microscope that uses accelerated electrons as a source of ...
Q: While staring at a black square CGMP is reduced in photoreceptors O photoreceptors have used up thei...
A: All GPCRs ( G - protein coupled receptors) are seven membrane spanning protein with their N- termina...
Q: When TRNAS and FRNAS have bases that H-bonds with other bases far apart from each other, the RNA mol...
A: Answer of this question is given below-
Q: By accident, you placed a mesophile organism in a growth medium at pH 8. You expected it to die but ...
A: Mesophiles are microorganisms that thrive at temperatures between 20 and 45 degrees Celsius, with an...
Q: Scientific Thought: "In evolutionary relationships using the evidences of evolution, the more closel...
A: DNA is the blueprint of life. DNA synthesizes RNA through transcription and finally translation of p...
Q: way can our diet affect the local or global soil organic matter and soil health? Explain thoroughly.
A: The loose surface layer that covers the bulk of land is understood as soil. it's created from each i...
Q: 1. Construct a map for the genes d,e,f. Assume that: d and e = 3%; e and f = 5%. Give 2 arrangements...
A: The genes that are located on the same chromosome are considered as linked genes because there alway...
Q: From what you have learned in Biology, why is membrane potential essential among plants and animals?
A: Membrane potential is the potential gradient which is created due to difference in electric potentia...
Q: Bacteria are typically grown at a temperature of 37oC. What happens to the membrane lipid compositio...
A: The membrane lipid bilayer is composed of polar head and non polar tails. The fuildity of membrane ...
Q: Organisms keep on evolving including human beings, how do you picture out the world would be 50 year...
A: Evolution : Evolution is the change in the characteristics of a species over several generations an...
Q: 3. If two gene pairs A and a and Band bare assorting independently with A dominant to a and B domina...
A: A dihybrid cross is a cross in which two types of traits / character are involved . As per the quest...
Q: How might your life and the lives of any children orgrandchildren you might have be affected if huma...
A: Human-caused changes in the water cycle have a significant impact on the concept of a sustainable fu...
Q: c) Mendelian ratios d) Genetic screen
A: The forward genetic analysis involves the identification of genes responsible for a particular pheno...
Q: what amino acid is coded for by the codon 5AAG3?
A: Proteins are constructed from amino acids. Each amino acid is made up of a carboxyl group and an a-a...
Q: What makes viruses different from the other microorganisms
A: Microorganisms are the organism which cannot be visible as such through eyes but require microscope ...
Q: Construct a map for the genes d,e,f. Assume that: d and e = 3%; e and f = 5%. Give 2 arrangements of...
A: Linkage map or chromosome map is the linear graphical representation of the sequence and a relative ...
Q: Cameerds Hake Samething insredancC Chenges Please use the following review questions to quide your w...
A: Hormones are defined as the biochemicals produced in a living organism in order to regulate various ...
Q: Question 9. What space inside the cell is topologically equivalent to the cytoplasm?
A: If molecules can flow in-between spaces within a cell without encountering a membrane, they are term...
Q: some enzymatic inhibitors
A: Enzyme inhibitors are molecules that interact in some way with enzymes and the rate of enzyme cataly...
Q: are
A:
Q: CHARACTER/ANIMAL PHARYNGEAL VERTEBRAE PAIRED SLITS AND SWIM APPENDAGES MUSCULAR SUCKER- FINS WITH MU...
A: Cladogram is a diagrammatic illustration which represents how the taxons are closely related to each...
Q: How would you explain the importance of tropicalrain forests (Core Case Study) to people who thinkth...
A: Tropical rain forests have an annual rainfall of 200-450 cm most of which occurs daily.
Q: Question 6 Describe in 4 steps the condensation of eukaryotic DNA to chromosomes. Describe each one ...
A: The DNA condensation is achieved by mitosis which is divided into prophase, metaphase, anaphase and ...
Q: List the 6 kingdoms in the order in which they came to be. What two domains include a single kingdom...
A: The whole Earth is inhabited by a large number of organisms. These organisms are both unicellular an...
Q: A. Angiosperms have complex and successful interactions with animals leading to effective pollinatio...
A: Given: Angiosperms are called flowering plants. In Angiosperms, the seeds are enclosed by fruits.The...
Q: Charcot-Marie-Tooth disease (CMT)causes motor and sensory neuropathies of the peripheral nervous sys...
A: Charcoot-Marie-Tooth disease (CMT) : The CMT caused by GJB1(Gap Junction Beta 1) and other unknown g...
Q: Which statement about N-linked glycosylation is correct? O N-linked oligosaccharides are attached to...
A: The modification of proteins can be done by adding carbohydrate molecules. These are called glycopro...
Q: Interpret a diagram of a bi-directional replication fork and correctly determine strand polarity and...
A: *Bidirectional replication is a kind of replication found in main kingdom organisms. *DNA replicatio...
Q: Question 26 The removal of a phosphate from cytidine yields the cytosine base. A True B) False Quest...
A: DNA known as deoxyribonucleic acid is a molecule which is responsible for the transmission and stora...
Q: 3. If two gene pairs A and a and Band bare assorting independently with A dominant to a and B domina...
A: As per Bartleby guidelines we are only permitted to solve 3 sub parts please post the other sub-part...
Q: 3) Biological molecules and their chemical properties affect cellular processes and biochemical reac...
A: Cell membrane is the lipid bilayer membrane having several other components that help in maintaini...
Q: 5. If you are able to successfully incorporate foreign DNA to your host organism, what are your majo...
A: A foreign DNA is a DNA that is transferred into a species from other source and not that of parent.
Q: Charcot-Marie-Tooth disease (CMT)causes motor and sensory neuropathies of the peripheral nervous sys...
A:
Q: discuss the effect of meditation on the brain.
A: Meditation It is a method of training attention and awareness. It helps in achieving cognitive clar...
Q: Create an informative essay showcasing the importance of evolution in our lives. With the changes in...
A: Evolution is a concept which was published by Charles Darwin, stating organisms change over time.
Q: What does the shaded area of map A represent? What does the shaded area of map B represent?
A: Two maps A and B are given in the question are of Africa continent . The given map shows the Correla...
Q: Question 19 Which of the following amino acids is not part of tetramer that is bounded to NAM and gl...
A: Answer--
Q: Figure 5.1 presented abbreviated pedigrees looking at the inheritance of X-linked human conditions. ...
A: Double heterozygote = Individual 1 in generation II, if the mother in generation I is homozygous wit...
Q: Question 13 Proteoglycans are a group of macromolecules formed from:
A: Proteoglycan are the proteins in which proteins are glycosylated. They are the major components of e...
Q: What is the complete name of the monosaccharide unit numbered 1? a-D-N-acetylglucosamine a-D-N-acety...
A: The given compound is an branched oligosaccharides. In a branched chain, the one with the longest ch...
Q: PCR primers Below is a 300 base pair fragment of DNA. The top strand is written in the 5' to 3' dire...
A: Introduction A primer is a single-stranded nucleic acid that all living organisms utilise to start t...
Q: organism's niche
A: A niche is the role a species plays in the ecosystem.
Q: Question 8 The invention of microscope pushed discoveries in biology to new heights. This shows how ...
A: Answer: The invention of microscope pushed discoveries in biology to new heights. This shows how tec...
Q: Question 47 Bacterial cell walls are composed of O chondroitin sulfate chains O peptidoglycans O hep...
A: The polysaccharides are made up of monosaccharide units that are present in bacteria, plants and ani...
Q: DNA positively supercoils during replication and negatively supercoils in transcription.
A: Transcription is a process where DNA replicate into RNA, while replication is the making of DNA cop...
Nucleotides
It is an organic molecule made up of three basic components- a nitrogenous base, phosphate,and pentose sugar. The nucleotides are important for metabolic reactions andthe formation of DNA (deoxyribonucleic acid) and RNA (ribonucleic acid).
Nucleic Acids
Nucleic acids are essential biomolecules present in prokaryotic and eukaryotic cells and viruses. They carry the genetic information for the synthesis of proteins and cellular replication. The nucleic acids are of two types: deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). The structure of all proteins and ultimately every biomolecule and cellular component is a product of information encoded in the sequence of nucleic acids. Parts of a DNA molecule containing the information needed to synthesize a protein or an RNA are genes. Nucleic acids can store and transmit genetic information from one generation to the next, fundamental to any life form.
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- 3. The sequence of bases on an mRNA strand is AAUCGACGCCCGACUAGC. List the codons present in this sequence. 4. List the tRNA anticodons that would pair with the codons present in the above sequence of mRNA. 5. Determine the translated amino acid sequence obtained from the mRNA strand given in question 3. You may use the genetic code table to translate. 6. A tRNA anticodon has the base sequence CCG. Identify the DNA base sequence that was used to produce the codon that will bind it to this anticodon. 7. Explain how you would determine whether a single chain of nucleotides is RNA or DNA. 8. Describe all the elements required to carry out the process of translation. 9. Describe the importance of DNA in determining the structure of a particular protein.1. It is a large complex ribonucleoprotein particle that chemically modifies the pre mRNA strand by the removal of introns 2. This is a linkage between paired bases in the secondary DNA structure 3. It refers to the linkage between 2 nucleotides in the DNA molecule 4. Give the range of the number of nucleotides present in a single protein molecule 5. Identify the number of bases included in the nucleosome 6. It is an enzyme that cuts the bacterial plasmid at its cleavage site1.1 What is the best description of a Ribosome? a. An enzyme that uses ribose to synthesize amino acids b. A protein/RNA complex that synthesizes protein c. A ribozyme that uses RNA as an enzyme to directly ligate free amino acids to tRNAs d. A multi-subunit protein complex that charges tRNA with amino acids 1.2 In RNA processing? A. Exons are added to the ends of mRNA for protection B. Intron sequences are removed before the mRNA is translated C. The RNA transcript that leaves the nucleus may be much longer than the original primary transcript D. All RNA transcripts will be processed and leave the nucleus.
- What is an anticodon, and where are they found? O a. Anticodons are complementary to codons, and are found in DNA genes O b. Anticodons are complementary to codons, and are embedded in tRNA molecules O c. Anticodons are antiparallel to codons ("backwards codons") and are found on the coding strand of the DNA gene O d. Anticodons encode amino acids and are found in mRNA molecules1. What is the nucleotide sequence of the complementary strand of the DNA molecule: 5’-AATGCGATCTTCAT-3’?2. What is the nucleotide sequence of the mRNA transcribed from the template DNA strand: 3’-GCTACAAAAAGTCCATAATCGC-5’? Indicate the 5’ and 3’ ends.3. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids? Indicate the N-terminal and C-terminal amino acids.1. Given the piece of MRNA: 5'-CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCC-3' 1. Predict the DNA strand sequence from which it was transcribe 2. List the complementary non-coding DNA Sequence 3. List the Amino acid Sequence of the protein coded for. Use the Genetic Code 2. Below is a short segment of a DNA molecule. Translate the DNA codon into MRNA. 5'- TACCATGAGAATTGTGG TCACCTTTTT-3' 3'- ATGGTACTCTTAACACCAGTGGAAAA A-5' MRNA Sequence Amino Acid Sequence
- 11) Examine the following two DNA sequences. Sequence 1: ATGCGATGCTAGCAT Sequence 2: ATGCGATGATAGCAT If both of these sequences code for proteins, how might the function of protein 2 differ from the function of protein 1? Use the table below for assistance. U C A G บบน UUC UUA UUG CUU CUC CUA CUG U Phe GUUT GUC GUA GUG Leu Leu AUU AUC lle AUA AUG Met or Start Val Ceweg 232 www... UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG C GCU GCC GCA GCG Ser Pro Thr Ala CAU CAC CAA CAG A AAU AAC AAA AAG UAU U UAC C UAA Stop UGA Stop A UAG Stop UGG Trp G Tyr GAA GAG His Gin Asn Lys GAU GAC Asp G c] Glu UGU UGC CGU CGC CGA CGG AGU AGC AGA AGG GGU GGC GGA GGG Cys Arg Ser Arg Gly U C A G U C A G U C A G by Calin me press A) Protein 1 and protein 2 will function exactly the same. B) Protein 1 will be shorter than protein 2, so they will not function the same. C) Protein 2 will be shorter than protein 1, so they will not function the same. D) Protein 2 has a different sequence, so it will function…Assume the first nucleotide in the sequence is at the +1 position. Transcribe the DNA sequence into mRNA and then translate it into the polypeptide. Give the polypeptide sequence in the following form: Met-Thr-Trp-Tyr-Val etc. 5' ACCGAAGGACTTATGGAGCGCTCATGATTTGCT 3'1. Create a DNA sequence with eighteen nucleotides. Indicate its 3’ on the left and 5’ on the right since that’s the template strand you will need in the next question to transcribe the mRNA. 2. Transcribe the DNA sequence above and separate the triplets into codons. Indicate 5’ and 3’ in the correct location on the strand. (Don’t worry about splicing- assume that the pre- mRNA is the same as the mature mRNA sequence) 3. Look at the genetic code, and indicate which amino acid is coded for by the codons in the above mRNA. 4. ANSWER BELOW QUESTIONS: A. First write the original DNA strand. Indicate where the substitution was by either circling it or writing it in a different color. Then write the mutated DNA sequence with the point mutation (aka substitution) wherever you choose for it to be. Again, circle it or write it in a different color. Do the same for the transcribed mRNA. Repeat the directions for 2 and 3 for this new DNA stand. (i.e., include the mRNA and translated protein…
- Assume the first nucleotide in the sequence is at the +1 position. Transcribe the DNA sequence into mRNA, and then translate it into the polypeptide. Give the polypeptide sequence in the following form: Met-Thr-Trp-Tyr-Val etc. 3' TCACAATACAAAGGTGTACTGATCTCATCTCCATAA 5'1. What is the nucleotide sequence of the mRNA transcribed from the template DNA strand: 3’-GCTACAAAAAGTCCATAATCGC-5’? Indicate the 5’ and 3’ ends. Follow the same format as the given sequence. 2. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids in the peptide? Use the 3-letter code of the amino acids. Separate the amino acids with a dash (-). NO NEED to indicate the N- and C-terminal amino acids. Assumption is that the first amino acid is the N-terminal. 3. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids in the peptide? Use the 3-letter code of the amino acids. Separate the amino acids with a dash (-). NO NEED to indicate the N- and C-terminal amino acids. The assumption is that the first amino acid is the N-terminal.In proteins, a peptide read from the N terminal to the C terminal. Is there a kind of direction in DNA/RNA as well? Briefly explain. What does Chargaff’s rules mean? Who proposed DNA was a double helix? In what decade? If one DNA single strand has the sequence 5’-AATGCAA-3’, what is the sequence of its complementary strand? When DNA replicates, how is it able to “unwind” its double helix?