Question 26The removal of a phosphate from cytidine yields the cytosine base.A TrueB) FalseQuestion 27The bonds linking bases and sugars are covalent.A TrueB) FalseQuestion 28Primary amines and keto groups of the nitrogen bases are involved in base-pairingin double stranded DNA.A TrueFalseQuestion 29The unique stem-loop structures of the transfer RNA helps the RNA perform itsfunction of joining ribosomal proteins to form the sites for protein synthesis.A TrueBFalse

Name: Question 26The removal of a phosphate from cytidine yields the cytosi
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Question 26The removal of a phosphate from cytidine yields the cytosine base.A TrueB) FalseQuestion 27The bonds linking bases and sugars are covalent.A TrueB) FalseQuestion 28Primary amines and keto groups of the nitrogen bases are involved in base-

DNA known as deoxyribonucleic acid is a molecule which is responsible for the transmission and…

Answered: Question 26 The removal of a phosphate…

Science

Biology

Question 26 The removal of a phosphate from cytidine yields the cytosine base. A True B) False Question 27 The bonds linking bases and sugars are covalent. A True B False

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter14: Dna Structure And Function

Section: Chapter Questions

Problem 34CTQ: Quinolone antibiotics treat bacterial infections by blocking the activity of topoisomerase. Why does...

See similar textbooks

Similar questions

QUESTION 21 Choose each of the characteristic(s) of all RNA polymerases from the list below. A. elongation adds new ribonucleotides to the 3-OH B. requires a primer to initiate synthesis C. have 3' to 5' exonuclease activity D. adds nucleotides based on sequence complementarity to a template E. have 5' to 3' polymerase activity O F. elongation adds new ribonucleotides to the 2'-OH G. have 3' to 5' polymerase activity
Question 2. Ribosomes are cellular structures that are composed of protein and RNA; this structure is responsible for catalyzing peptide bond formation between amino acids during a process known as translation. a) Many antibiotics that kill bacteria target translation. Why might this be an effective mechanism to kill bacteria? Why don't antibiotics also kill human (eukaryotic) ribosomes? b) The antibiotic Kasugamycin (KSG) destabilizes the P-site of the ribosome. Describe what parts of translation would be altered in the presence of this antibiotic. c) How does the following graph show the efficacy of translational knockdown with KSG? Met-Methionine C % of Met incorporation 100 80 60 40 20 0 + 0 2 4 6 8 KSG concentration (mg/ml) 10
Question:- 1. Transcribe and translate the given region of DNA, note that the promoter region is to the right of the sequence, and translation must start from the start codon. Include 3' and 5' for RNA transcript and N- and C- terminus in your final peptide sequence. Use the 1-letter form of amino acids when writing the sequence of polypeptide 5' CCCCAGCGTAAGTTTATGGTTACTCATGAA 3' 3' GGGGTCGCATTCAAATACCAATGAGTACTT 5'
Remodeling complexes use the energy from ATPhydrolysis to change the position of nucleosomes,exposing promoters and allowing gene ____________.
Question 43 The addition of restriction endonucleases in the cloning process is done following the ligation with DNA ligase. A) True B) False
Question 10. Which statement on the migration of DNA fragments through agarose gels is false A) Small fragments migrate faster than larger fragments because they can move faster through the agarose pores. B) Large fragments migrate faster than small fragments because they carry more negative charges. C) DNA fragments migrate towards the positive pole. D) Supercoiled DNA may migrate significantly different through the gel than linear DNA of equal size. E) The higher the agarose concentration the better the separation of smaller fragments as compared to larger fragments.
Question 45 When TRNAS and rRNAs have bases that H-bonds with other bases far apart from each other, the RNA molecules assume its secondary and tertiary structure. A) True B) False
Question 1A Explain why DNA replication requires RNA primers. What do they do and why do they have to be removed?
Question 39 The graphic below shows Taq polymerase extending the primer upon a strand of DNA. What is a possible resulting sequence of the complementary strand after the reaction is finished assuming adequate amounts of all normal nucleotides and some ddGTP? 5' 5' O GATGC O TGCG O ATGC AGATGC с POLYMERASE 3" T G C '5' 3º in
QUESTION NO. 1 Base excision repair A. is used only for bases that have been deaminated. B. uses enzymes called DNA glycosylases to generate an abasic sugar site. C. removes about 10 to 15 nucleotides. D. does not require an endonuclease. E. recognizes a bulky lesion. QUESTION NO. 2 Termination of a prokaryotic transcriptA. is a random process. B. requires the presence of the rho subunit of the holoenzyme. C. does not require rho factor if the end of the gene contains a G-C rich palindrome. D. is most efficient if there is an A-T-rich segment at the end of the gene. E. requires an ATPase in addition to rho factor. QUESTION NO. 3 Eukaryotic transcription A. is independent of the presence of upstream consensus sequences. B. may involve a promoter located within the region transcribed rather than upstream. C. requires a separate promoter region for each of the three ribosomal RNAs transcribed. D. requires that…
Question 45 Once the RNA primers are replaced the fragments in the lagging strands are sealed by DNA pol I. A True B) False
Question 19 The polymerase chain reaction requires the following except A primers complementary to the ends of the sequence to be amplified B) carefully controlled temperature conditions cycles of denaturation, annealing and extension RNA polymerase to synthesize RNA primers