How many statements are right? 1. operator is a protein (transcription factor) that interacts with a DNA sequence immediately downstream the promoter region 2. Type I restriction endonucleases cleave DNA at specific sites, close to recognition sequence 3. Type II restriction endonucleases cleave DNA within or at short specific distances from the recognition site 4. Type III restriction endonucleases Cleave DNA at random sites, cleave DNA near the recognition sequence 5. Type IV restriction endonucleases: Target only methylated DNA 3. O 1 O 2- 4.

How many statements are right? 1. operator is a protein (transcription factor) that interacts with a DNA sequence immediately downstream the promoter region 2. Type I restriction endonucleases cleave DNA at specific sites, close to recognition sequence 3. Type II restriction endonucleases cleave DNA within or at short specific distances from the recognition site 4. Type III restriction endonucleases Cleave DNA at random sites, cleave DNA near the recognition sequence 5. Type IV restriction endonucleases: Target only methylated DNA 3. O 1 O 2- 4.

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter18: Dna Technologies: Making And Using Genetically Altered Organisms, And Other Applications

Section: Chapter Questions

Problem 3TYK: Why are antibiotic resistance markers such as ampR important components of bacterial plasmid cloning...

See similar textbooks

Similar questions

Producing Insulin Many diabetics are treated using recombinant insulin. Place the following steps involved in producing insulin in order. 1 | Gene is expressed in the bacteria to make large amounts of insulin 2 E Identify the gene for insulin 3 | Clone the bacteria with the recombinant plasmid 4 Insulin inserted into a plasmid Inserted plasmid into bacterial cell 6 | Use restriction enzymes to remove insulin gene LO
1. What are restriction enzymes and what do they do? 2. Complete the chart Original DNA sequence 5' TGA CCA CTC GAG CAT AAC GAG TCG CTC 3° Write the complementary strand's sequence * remember it will be opposite directionality (the number at the ends are different) * pairs are A-T and C-G |Copy and paste your double stranded DNA into this box. You are going to use the restriction enzyme Xhol. Mark the cut site by changing the color (highlight or change text color) of one double-stranded piece * it cuts between the C and the T (cut shown as slash symbol): 5’ C/TC GAG 3' * remember it cuts BOTH strands (the restriction site is palindromic). Hint: read each strand in the 5'à 3' directions to find the cut site
vvnicn the following statements are correct about the repair of a DNA duplex containing the sequence below that is grown INE coli (select all that apply)? Strand A Strand B GATCTAGCCGGCATCCGAT CTAGATCGGACGTAGGCTA Methyl ✔A. MutH cleaves Strand A O B. DNA repair will result in the bold A in strand B being replaced with a C O C. DNA repair will result in the bold G in strand A being replaced with a T ✔ D. Defect will not be properly repaired in dam(-) E coli O E. The mammalian repair system would also correct the mismatch shown based on the methylation status of the DNA
Part 4. Putting It Together 1) Consider the diagram below as well as the given information. This diagram represents a piece of circular DNA which was cut in 4 separate reactions (4 different test tubes, each with some of this DNA in it). One digest was done with AvaI, another with ClaI, a third with EcoRV, and a fourth with ScaI. The locations of the recognition sequences for each restriction enzyme are shown along with the location of that site in bp along the circle (it goes clockwise from position 1). You run an agarose gel with a molecular weight marker in the first lane, the AvaI digest in lane 2, the ClaI digest in lane 3, the EcoRV digest in lane 4, and the ScaI digest in lane 5. a) Use the space below and draw out the agarose gel described above. Use your drawing to answer the next questions. b) How many bands of DNA are there in lane 3? c) How many bands of DNA are there in lane 5? d) There would be 2 bands of DNA in lane 4. How big are they? e) Which lane…
Coding With the given coding strand perform the following 1. supply the correct non- coding strand 2. Identify the location of following restriction enzyme by enderlining it in the coding strands 3. Supply the correct non-coding strands for the two restriction enzymes EcoRi - 5' GAATTC 3'BamH1 - 5' GGATTC 3' 5' ATGCATGGTACGTAGAGTTCCATGAATTCGCCCCTATAGGGTAGCCGAGGATTCTATGCCCGAATGTC 3'
Why are antibiotic resistance markers such as ampR important components of bacterial plasmid cloning vectors? a. The plasmid must have resistance to accept DNA inserts. b. They allow the detection of plasmids that contain an inserted DNA fragment. c. They ensure the presence of the ori site. d. They ensure that the plasmid can be cut by a restriction enzyme. e. They allow identification of bacteria that have taken up a plasmid.
1. For each of the items below, give a brief description (indicate function for enzymes) and indicate in which process (replication, transcription, or translation) it is involved with. Description/Funetion catalyzes the unwinding of DNA strands Process involved in helicase replication 1. RNA primer 2. leading strand 3. RNASE 4. anti-sense strand 5. anticodon 6. RNA polymerase II 7. DNA polymerase 8. promoter site 9. DNA ligase 10. exit site
9. The restriction site sequence for the restriction enzyme Sau3Al and BamHI include four identical bases, making their sticky ends identical as shown in the figure. Let's say you have foreign DNA whose flanking regions were cut with Sau3AI. Also, you want to use a plasmid containing a BamHI restriction site. (1) Would it be possible to ligate the foreign DNA into the BamHI site of the plasmid? Explain. lison Lenharc (2) Would it be possible to cut the ligated sites with Sau3AI? What about BamHI? What problems will you expect if you use BamHI? BamHI Sau3Al G-G-A-T-C-C பர்டிய C-C-T-A-G-G G-A-T-C Hi- 目1目 C-T-A-G C-C-T-A-G C-T-A-G G-A-T-C-C E E G-A-T-C= 10. An ampicillin-resistant, tetracycline-resistant plasmid, pBR322, is cut with Pstl, which cleaves within the ampi resistance gene. The cut plasmid is ligated with Pstl digested Drosophila DNA to prepare a genomic library, and t rcoli K12
Part 3. Restriction Enzymes 1) Consider the sequence of DNA given below and answer the following questions 5’ ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG 3’ 3’ TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC 5’ a) You cut the sequence of DNA shown above using BamHI (see table 19.1 from the text). How many fragments of DNA would you expect to result from this restriction digest? b) If you cut the sequence of DNA shown above using BclI (recognition sequence = 5’ TGATCA 3’, enzyme cuts after the first T) instead of BamHI how many fragments do you expect? 2) For each given sequence/restriction enzyme pair, determine how many pieces of DNA would result form the digest and indicate whether those pieces would have blunt or sticky ends. NOTE: in the given recognition sites, the dash represents where the cut is made. a) HpaI, recognizes 5’ GTT – AAC 3’ 5’ GGATGTTAACAATCTCTACGGGTTAACACCCTTGGGTTAACATCCGCGG 3’ 3’ CCTACAATTGTTAGAGATGCCCAATTGTGGGAACCCAATTGTAGGCGCC 5’ Number of fragments of DNA:…
Why are Gyrase inhibitors good antibiotics to use therapeutically? DNA Gyrase is required by prokaryotes, but not eukaryotes, to complete chromosomal replication so it's a good target to inhibit. O DNA Gyrase is required by eukaryotes, but not prokaryotes, to complete chromosomal replication so it's a good target to inhibit. It's impossible to develop resistance against Gyrase inhibitors so they are always effective. O DNA Gyrase is required by both prokaryotes and eukaryotes to complete chromosomal replication so it's a good target to inhibit.
Section B: True / False 1. The two sequences shown below are complementary to each other. T or F GTCGAC CAGCUG 2. Telomerase possesses RNA polymerase activity. T or F 3. Topoisomerase binds to DNA ahead of the replication fork. T or F snRNA is not transcribed during translation. T or F 5. Promoter is located in the intron of pre-mRNA. T or F Poly-A tail is added to RNA in bacteria. T or F Translation stops when Stop codon arrives E site in ribosome. T or F EF-G is used in translation termination. T or F 9. A subunit of hemoglobin carries more oxygen molecule than a myoglobin does. T or F 10. The formation of carbamate group in hemoglobin reduces its affinity to oxygen. T or F 4. 6. 7. 8.
#1 HindII --- 5’ GTC ↓ GAC 3’ 5’ ACGACGTAGTCGACTTATTAT GTCGACCCGCCGCGTGTCGACCATCA 3’ 3’ TGCTGCATCAGCTGAATAATACAGCTGGGCGGCGCACAGCTGGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut: