1. For each of the items below, give a brief description (indicate function forenzymes) and indicate in which process (replication, transcription, or translation) itis involved with.Description/Funetioncatalyzes the unwinding of DNA strandsProcess involved inhelicasereplication1. RNA primer2. leading strand3. RNASE4. anti-sense strand5. anticodon6. RNA polymeraseII7. DNA polymerase8. promoter site9. DNA ligase10. exit site

The process of replication and transcription are catalysed by different Enzymes and proteins. The…

Answered: 1. For each of the items below, give a…

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

1. For each of the items below, give a brief description (indicate function for enzymes) and indicate in which process (replication, transcription, or translation) it is involved with. helicase Description/Funetion catalyzes the unwinding of DNA strands Process involved in replication 11. terminator 12. ribosome 13. amino-acyl RNA site 14. MRNA 15. tRNA 16. rRNA 17. Shine-Dalgarno sequence 18. start codon 19. Okazaki fragments 20. coding strand 21. peptidyl tRNA site
Section B: True / False (5 marks) 1. Primase has a DNA dependent RNA polymerase activity. 2. 7-methylguanosine cap is added to the 5' end of the DNA after replication in eukaryotes. 3. snRNA is produced in transcription. 4. Initiator tRNA enter ribosome with the help of EF-Tu. 5. At low oxygen partial pressure Po2, myoglobin has lower oxygen affinity than hemoglobin.
2. Refer to the protein phe-trp-tyr-cys-ala-met-leu, construct a DNA strand that can transcript an mRNA and tRNA that can produced that proteina. mRNA strandb. tRNA strandc. DNA strand (5’-3’)d. DNA strand (3’-5’)
2) Create an MRNA strand based on the given DNA template strand: TACTT CCTATTITCT IGTCA CCGCACT
6. Similar to the class notes (Intro to Genetics), a segment of DNA (shown below) contains a promoter segment (the first 9 base pairs), a ribosome binding segment (the next 6 base pairs), and a segment that codes for protein synthesis which is started by the rest of the base pairs. ACTCCATTGAACCATTTCTATGATCCGCTAACG-... TGAGGTAACTTGGTAAAGATACTAGGCGATTGC-... A. When the DNA is induced to be copied to mRNA, the top strand is coding, meaning that the mRNA makes an identical copy of the lower strand (replacing T with U) The mRNA copy starts with the ribosome binding sequence. What is the sequence of the mRNA that will go to the ribosomes? B. What are the first 6 amino acids of the protein that are coded for by the mRNA? C. What would the amino acid sequence be if... i. a transition mutation occurred on the final G in the mRNA? ii. all of the G & C bases in the protein synthesis portion had transition mutations? iii. a point deletion mutation occurred in the ATA sequence (in the lower strand…
1. Determine what amino acid will be formed from the given DNA strand below: 3’ T A C A T G C C G A A T G C C 5’ 2. how will replication happen by mentioning the enzyme needed then transcribe to form mRNA. 3. Discuss what will happen to mRNA, then translate, mentioning the anticodon to be used 4. Look at the genetic code to know what amino acid will become part of the polypeptide chain.
2. Refer to the protein phe-trp-tyr-cys-ala-met-leu, construct a DNA strand that can transcript an MRNA and tRNA that can produced that protein a. MRNA strand b. tRNA strand c. DNA strand (5'-3') d. DNA strand (3'-5')
7( what is the diagram depictin A) transcription and translation return B. DNA replication C -DNA replication transcription and translation D-transcription E- translation
26. Using the following DNA strand, write out the mRNA, and then the amino acids. DNA: 3' T- A- C- A- A- G- T- A- C- T- T- G- T- T- T- C- T- T- A- A- A 5' A LIGUULAUGAOLAAAGAAUUL Phe- MRNA: Amino Acids: met Phe- met Asme -LyS- G la- 27. Suppose the two guanosine (G) nucleotides in3 above were changed to two cytosine (C) nucleotides. What is the new amino acid chain? 28. Suppose the two guanosine (G) nucleotides in #3 were removed from the DNA strand. How would this mutation affect the amino acid chain? Write out the new amino acid chain.
II. Use the eukaryotic gene DNA sequence below to answer the following questions: 1 11 21 CGACTTACTG 51 TGGACGCGCC 101 61 GGCGTATAAA GCGACGACTG TAGACTGATG AGCCTATCCA 111 71 121 31 ATGGCCCTGT AAGCGGTGCG ATGCAATAAA ACGCGTATCA 81 Polyadenylation signal in the corresponding mRNA: Kozak's sequence in the corresponding mRNA: Start (initiation) codon in the corresponding mRNA: Stop (termination) codon in the corresponding mRNA: 61-69 c. Where is the 3' UTR? Circle one. 70-111 14-60 131 41 GTCATTCAGC GTAGTCTGAT GCCAGTCGAC TGCATTGGAC ACCGGTTACA 91 a. Write the corresponding sequences, circle & label them in the sequence above: TATA box sequence: (label as TATA) 37-45 73-90 141 (label as poly-A) b. What region of mRNA contains the open reading frame that will be translated into protein? Circle one. 51-111 (label as Kozak) (label as start) (label as stop) 71-81 85-150
2)For each item in the following table, decide whether it is related or involved in transcription, translation or replication. 1. Splicing 2. Stop codon 3. Lagging strand 4. RNA polymerase 5. DNA polymerase 6. Telomerase
8. For the double strand DNA molecule below, assume the 3' DNA strand acts as the template for creating the MRNA. Write the corresponding MRNA 5' 1 3' and translate this mRNA into protein. DNA 3' CGTGAATACGCTACGGAACTCACTGGTA 5' DNA 5' GGCACTTATGCGATGCCTTGAGTGACCAT 3' MRNA 5' Protein UCAGUCAG UCPG Alanine GU U/c GU A Tyrosine C Stop A G Cysteine Valine G A Stop G Tryptophan Arginine A G AC A C UG ACUGACU C Leucine Serine G C A Lysine Proline Asparagine Glycine alanine Leucine Phenyl- Serine Glutamic acid Aspartic acid Histidine Glutamine Threonine

SEE MORE QUESTIONS

Recommended textbooks for you

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

ISBN:

9781305961135

Author:

Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal

Publisher:

Cengage Learning

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Fundamentals of General, Organic, and Biological …

Biochemistry

ISBN:

9780134015187

Author:

John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson

Publisher:

PEARSON

SEE MORE TEXTBOOKS