1. For each of the items below, give a brief description (indicate function forenzymes) and indicate in which process (replication, transcription, or translation) itis involved with.helicaseDescription/Funetioncatalyzes the unwinding of DNA strandsProcess involved inreplication11. terminator12. ribosome13. amino-acyl RNAsite14. MRNA15. tRNA16. rRNA17. Shine-Dalgarnosequence18. start codon19. Okazakifragments20. coding strand21. peptidyl tRNAsite

Answered: Image /qna-images/answer/d55dcfde-0896-4e1b-8363-0847b0e7f6df.jpg

Answered: 1. For each of the items below, give a…

BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)

10th Edition

ISBN:9781305967359

Author:STARR

Publisher:STARR

Chapter9: From Dna To Protein

Section: Chapter Questions

Problem 16SA

See similar textbooks

Similar questions

6. Similar to the class notes (Intro to Genetics), a segment of DNA (shown below) contains a promoter segment (the first 9 base pairs), a ribosome binding segment (the next 6 base pairs), and a segment that codes for protein synthesis which is started by the rest of the base pairs. ACTCCATTGAACCATTTCTATGATCCGCTAACG-... TGAGGTAACTTGGTAAAGATACTAGGCGATTGC-... A. When the DNA is induced to be copied to mRNA, the top strand is coding, meaning that the mRNA makes an identical copy of the lower strand (replacing T with U) The mRNA copy starts with the ribosome binding sequence. What is the sequence of the mRNA that will go to the ribosomes? B. What are the first 6 amino acids of the protein that are coded for by the mRNA? C. What would the amino acid sequence be if... i. a transition mutation occurred on the final G in the mRNA? ii. all of the G & C bases in the protein synthesis portion had transition mutations? iii. a point deletion mutation occurred in the ATA sequence (in the lower strand…
II. Use the eukaryotic gene DNA sequence below to answer the following questions: 1 11 21 CGACTTACTG 51 TGGACGCGCC 101 61 GGCGTATAAA GCGACGACTG TAGACTGATG AGCCTATCCA 111 71 121 31 ATGGCCCTGT AAGCGGTGCG ATGCAATAAA ACGCGTATCA 81 Polyadenylation signal in the corresponding mRNA: Kozak's sequence in the corresponding mRNA: Start (initiation) codon in the corresponding mRNA: Stop (termination) codon in the corresponding mRNA: 61-69 c. Where is the 3' UTR? Circle one. 70-111 14-60 131 41 GTCATTCAGC GTAGTCTGAT GCCAGTCGAC TGCATTGGAC ACCGGTTACA 91 a. Write the corresponding sequences, circle & label them in the sequence above: TATA box sequence: (label as TATA) 37-45 73-90 141 (label as poly-A) b. What region of mRNA contains the open reading frame that will be translated into protein? Circle one. 51-111 (label as Kozak) (label as start) (label as stop) 71-81 85-150
Section B: True / False (5 marks) 1. Primase has a DNA dependent RNA polymerase activity. 2. 7-methylguanosine cap is added to the 5' end of the DNA after replication in eukaryotes. 3. snRNA is produced in transcription. 4. Initiator tRNA enter ribosome with the help of EF-Tu. 5. At low oxygen partial pressure Po2, myoglobin has lower oxygen affinity than hemoglobin.
1. Considering the following nucleotide sequence in an mRNA molecule: 5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3' a) Write the sequence of the DNA template (antisense) strand from which the mRNA was synthesized. b) Write the sequence of the DNA coding (sense or informational) strand complementary to the template strand. c) Write the sequence of tRNA anticodon that corresponds to the given mRNA molecule. d) Write the amino acid sequence of the peptide synthesized from the given mRNA nucleotide sequence. e) Draw the structure of the pertide fragment made up of the first five (5) amino acids in the given polypeptide.
1. Given the piece of MRNA: 5'-CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCC-3' 1. Predict the DNA strand sequence from which it was transcribe 2. List the complementary non-coding DNA Sequence 3. List the Amino acid Sequence of the protein coded for. Use the Genetic Code 2. Below is a short segment of a DNA molecule. Translate the DNA codon into MRNA. 5'- TACCATGAGAATTGTGG TCACCTTTTT-3' 3'- ATGGTACTCTTAACACCAGTGGAAAA A-5' MRNA Sequence Amino Acid Sequence
D. The sequence of a eukaryotic gene is given below, where in boed an inset containing: 5'GA TTATGGAATTCACCTAT GATCGCAT GGCCATTGAACCT 3 3CTAATACETTAAGTGGATA CTAGCGTA CCGGTAACIT GGA 5 A. Write the sequence of the WRNA produced by its process of transcription and of wRNA that is transferred to ribosomes in order to produce the peptide B. A mutation has occured in the above gene. The GIC pair highlighted replaced by T/A. Cells that are homozygous for that mutation become Cancerous. Do think this gene is a you proto-oncogene? or a tumor suppressor gene and why? describes D₂. The following family tree is given which the way inheritance of a dease. It is noted that only one of its two persons generation I is heterozygous and that one of the individuals in subsequent generations exhibits unexpected Phenotype. Individuals II4 and III2 show its phenotype disease. The remaining individuals have normal phenotype. α
Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
Briefly describe the function of the following in protein synthesis. a. rRNA b. tRNA c. mRNA
Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?
A part of an mRNA molecule with the sequence 5-UGC GCA-3 is being translated by a ribosome. The following activated tRNA molecules are available. tRNA Anticodon Amino Acid 3-GGC-5 Proline 3-CGU-5 Alanine 3-UGC-5 Treonine 3-CCG-5 Glycine 3-ACG-5 Cysteine 3-CGC-5 Alanine Which two of them can bind correctly to the mRNA so that a dipeptide can form? a. cysteinealanine b. prolinecysteine c. glycinecysteine d. alaninealanine e. threonineglycine
Consider the following DNA sequence: CATGTGTAGTCTAAA. Address the followin questions: AWrite the sequence of the DNA strand that would be replicated from this one. GTACACATCAGATT 2. White the sequence of the messenger RNA (MRNA) molecule that would be transcribed from the DNA strand. 30 GUACACAUCAGAU00 37 38 39 3. State how many codons the sequence specifies. 40 41 42 43 44 4. State how many amino acids the sequence specifies. 45
Name (Last, First): DNA An RNA polymerase attaches to the DNA and transcribes the DNA to mRNA Ribosone BIO 340 Activity # 1: DNA and the Central Dogma Complete: DNA Coding 5' ATG TGG ATT CTC AAG ATC AAT AGT 3' DNA template 3 5' Cytoplasm Nuckus Nuclear pore ARNA Use the mRNA codon sequence and the genelic Landelable in order to find the amino acid (AA) sequence of the protein. Example: if mRNA sequence is GUU then the corresponding amino acid 3-letter is Valine (Val) and the corresponding amino acid 1-letter is V. mRNA codon 5' FIRST (5') LETTER tRNA codon 3 U AA 3-letter AA 1-letter Amino acid AA - Amino acid A tRNA THE GENETIC CODE New protein being built U Pie (F) ասա UUC) ԼԱՔ Uva) Lou (L) Leu (L) val (M) Use numbers 1 to 3 to indicate the correct order of the flow of biological information. Translation Replication Transcription Hydroxyl group Deoxyribose sugar DNA's charge is negative due to following (circle the correct one): An alpha helix and a beta sheet in a protein are a type…

SEE MORE QUESTIONS

Recommended textbooks for you

BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)

Biology

ISBN:

9781305967359

Author:

STARR

Publisher:

CENGAGE L

Biology: The Dynamic Science (MindTap Course List)

Biology

ISBN:

9781305389892

Author:

Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:

Cengage Learning

Human Heredity: Principles and Issues (MindTap Co…

Biology

ISBN:

9781305251052

Author:

Michael Cummings

Publisher:

Cengage Learning

BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)

Biology

ISBN:

9781305967359

Author:

STARR

Publisher:

CENGAGE L

Biology: The Dynamic Science (MindTap Course List)

Biology

ISBN:

9781305389892

Author:

Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:

Cengage Learning

Human Heredity: Principles and Issues (MindTap Co…

Biology

ISBN:

9781305251052

Author:

Michael Cummings

Publisher:

Cengage Learning

Biology (MindTap Course List)

Biology

ISBN:

9781337392938

Author:

Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:

Cengage Learning

Human Biology (MindTap Course List)

Biology

ISBN:

9781305112100

Author:

Cecie Starr, Beverly McMillan

Publisher:

Cengage Learning

SEE MORE TEXTBOOKS