Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom: 5'-ATGCTGCGTGCATGGGATATAGGTAGCACACGTCC-3' 3'-TACGACGCACGTACCC TATATCC ATCGTGTGCAGG-5' Would there be an effect on translation of changing the fourth A in the template strand to a C? If so, what effect? AGA AGG GCA CGA GCC CGC GCG CGG GAC AAC UGC GAA CAA GGG CAC AUCC CUG AAA UUA UUG CUA AUA CUC AGC AGU CCA ÜCA ACA CCC UCC ACC UUC CCG UCG ACG GGA GGC GUA GUC UAC GUG UAA UAG UGA GCU CGU GAU AAU UGU GAG CAG GGU CAU AUU CUU AAG AUG ÚÚÛ CCU ÚČU ACU UGG UAU GUU Ala Arg Asp Asn Cys Glu Gin Gly His lle Leu Lys Met Phe Pro Ser Thr Trp Tyr Val stop A R D G IL K Y V

Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom: 5'-ATGCTGCGTGCATGGGATATAGGTAGCACACGTCC-3' 3'-TACGACGCACGTACCC TATATCC ATCGTGTGCAGG-5' Would there be an effect on translation of changing the fourth A in the template strand to a C? If so, what effect? AGA AGG GCA CGA GCC CGC GCG CGG GAC AAC UGC GAA CAA GGG CAC AUCC CUG AAA UUA UUG CUA AUA CUC AGC AGU CCA ÜCA ACA CCC UCC ACC UUC CCG UCG ACG GGA GGC GUA GUC UAC GUG UAA UAG UGA GCU CGU GAU AAU UGU GAG CAG GGU CAU AUU CUU AAG AUG ÚÚÛ CCU ÚČU ACU UGG UAU GUU Ala Arg Asp Asn Cys Glu Gin Gly His lle Leu Lys Met Phe Pro Ser Thr Trp Tyr Val stop A R D G IL K Y V

Name: Here is the sequence of a portion of a bacterial gene. The template s
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:5'-ATGCTGCGTGCATGGGATATAGGTAGCACACGTCC-3'3'-TACGACGCACGTACCC TATATCC ATCGTGTGCAGG-5'Would there be an effect on translation of changing the fourth A in the t

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 16QP: Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also,...

See similar textbooks

Similar questions

Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom: 5’-ATGCTGCGTGCATGGGATATAGGTAGCACACGTCC-3’ 3’-TACGACGCACGTACCC TATATCC ATCGTGTGCAGG-5’ Would there be an effect on translation of changing the fourthA in the template strand to a C? If so, what effect?
Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom: 5’- ATGCTGCGTGCATGGGATATAGGTAGCACACGTCC-3’ 3’-TACGACGCACGTACCC TATATCC ATCGTGTGCAGG-5’ (a) Assuming that transcription starts with the first C in the template strand, and continues to the end, what would be the sequence of the mRNA derived from this fragment?
Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:5’-ATGCTGCGTGCATGGGATATAGGTAGCACACGTCC-3’3’-TACGACGCACGTACCC TATATCC ATCGTGTGCAGG-5’(a) Assuming that transcription starts with the first C in the template strand, and continues to the end, what would be the sequence of the mRNA derived from this fragment? (b) Find the initiation and stop codons in this mRNA. (c) Would there be an effect on translation of changing the fourth T in the template strand to a C? If so, what effect? (d) Would there be an effect on translation of changing the fourth A in the template strand to a C? If so, what effect?
Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom: 5’-ATGCTGCGTGCATGGGATATAGGTAGCACACGTCC-3’ 3’-TACGACGCACGTACCC TATATCC ATCGTGTGCAGG-5’ (a) Assuming that transcription starts with the first C in the template strand, and continues to the end, what would be the sequence of the mRNA derived from this fragment? (b) Find the initiation and stop codons in this mRNA
Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom: 5'-ATGCTGCGTGCATGGGATATAGGTAGCACACGTCC-3' 3'-TACGACGCACGTACCC TATATCC ATCGTGTGCAGG-5' (a) Assuming that transcription starts with the first C in the template strand, and continues to the end, what would be the sequence of the MRNA derived from this fragment? (b) Find the initiation and stop codons in this mRNA. (c) Would there be an effect on translation of changing the fourth T in the template strand to a C? If so, what effect? (d) Would there be an effect on translation of changing the fourth A in the template strand to a C? If so, what effect? AGA UUA UUG CUA AUA CUC GCA CGA GUA GUC ACA UAA UAG UGA UUC CCG ACG GCU CGU GAU AAU UGU GAG CAG GGU CAU AUU CUU AAG AUG UUU CCU UCU ACU UGG UAU GUU Ala Arg Asp Asn Cys Glu Gin Gly His le Leu Lys Met Phe Pro Ser The Trp Tyr Val stop DNCE M FP HIL
Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom: 5’-ATGCTGCGTGCATGGGATATAGGTAGCACACGTCC-3’ 3’-TACGACGCACGTACCC TATATCC ATCGTGTGCAGG-5’ Assuming that transcription starts with the first C in the template strand, and continues to the end, what would be the sequence of the mRNA derived from this fragment? Q) Would there be an effect on translation of changing the fourthT in the template strand to a C? If so, what effect?
Consider the following DNA template: 5’-AAGAGGTTCCAATGCAGGCACTCACCAACTCTTAAATAAA-3’ 3’-TTCTCCAAGGTTACGTCCGTGAGTGGTTGAGAATTTATTT-5’ If the bottom DNA strand is used as template to transcribe mRNA, predict the amino acid sequence that would result from the process of translation. Met-Ala-Leu-Thr-Gln-Glu-Gly Met-Gly-Ser-Leu-Asn-Ser-Gln Met-Thr-Asn-Ser-Leu-Ala-Gln Met-Gln-Ala-Leu-Thr-Asn-Ser Met-Glu-Ala-His-Trp-Ser-Tyr
For this double stranded DNA: 3’-AGGTCCAGTCTTCGGCGGATGATCGGGCCAACCCCCGTAACTGGTCACCGGAATGCC-5’ 5’-TCCAGGTCAGAAGCCGCCTACTAGCCCGGTTGGGGGCATTGACCAGTGGCCTTACGG -3’ , while using the bottom strand is the template for transcription. If the START CODON is AUG and the STOP CODON IS UGA, how many amino acids are in the encoded protein and what is the primary structure?
For this double stranded DNA: 3’-AGGTCCAGTCTTCGGCGGATGATCGGGCCAACCCCCGTAACTGGTCACCGGAATGCC-5’ 5’-TCCAGGTCAGAAGCCGCCTACTAGCCCGGTTGGGGGCATTGACCAGTGGCCTTACGG -3’ , while using the bottom strand is the template for transcription. If the START CODON is AUG and the STOP CODON IS UGA, what would it look like drawn out?
Give the RNA molecule sequence transcribed from the following DNA sequence of a eukaryotic gene and with the correct 5' and 3' ends. DNA: 5'-ATAGGGCATGT-3' 3'-TATCCCGTACA-5' <--- template strand Group of answer choices 5'-ATAGGGCATGT-3' 3'-UAUCCCGUACA-5' 5'-AUAGGGCAUGU-3' 3'-TATCCCGTACA-5'
The following DNA strand is a template strand (also called non-coding strand) of an E. coli gene. Arrow indicates the direction of transcription. The asterisk indicates t transcription initiation site GCAGTGACCGGATATAACGAAGAGGAATGCCGTACAAA 5' GCAGTGA 3' -10 Which of the following sequences accurately represents the RNA derived from this gene? C5' UCCUUAC 3' C3' UCCUUAC 5' C5' CGUCACU 3' +10 3' AGGAATG 5'
Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom: 5’-ATGCTGCGTGCATGGGATATAGGTAGCACACGTCC-3’ 3’-TACGACGCACGTACCC TATATCC ATCGTGTGCAGG-5’ Q) Find the initiation and stop codons in this mRNA?