List the sequences of the mRNA molecules transcribed from thefollowing template DNA sequences:a. T G A A C T A C G G T A C C A T A Cb. G C A C T A A A G A T C
Q: DNA MRNA AUG ACU AGC UGG GGG UAU UAC UUU UAG Amino Acid DNA TAC CGC TCC GTC GCC GAC AAT АСС ACT mRNA…
A: CENTRAL DOGMA:- The whole process of Central Dogma involves two processes:- 1) When DNA changes into…
Q: The function of the genetic code is toa. promote transcription.b. specify the amino acids within a…
A: Genetics can be defined as the branch of biology which is concerned with the study of genes, genetic…
Q: The function of the genetic code is toa. promote transcription.b. specify the amino acids within a…
A: Genetic code is a set of rules used by living organism’s cells in the process of translation that is…
Q: . List the sequences of RNA that would be transcribed template sequences. a. Ans:…
A: Since you have posted a question with multi- sub parts , we will solve first three sub-parts for…
Q: If the DNA sequence is ATG-CGT, the mRNA codons are ___. ATG-CGT UAC-GCA GUA-CGU AUG-CGU…
A: DNA full form is deoxyribonucleic acid. DNA is the main constituent of the chromosome. It contains…
Q: Tell whether the following elements are found on DNA or RNA: a. -10 region b)e. poly(A) tai c).…
A: a) -10 region is found in DNA. it is also called pribnow box and is an essential part of a promoter…
Q: transcribed RNA
A: Transcription is the process of copying a segment of DNA into RNA. Only one of the two DNA strands…
Q: The mRNA sequence AUG CAC AGU codes for the first three amino acids of a particular protein. Which…
A: The mRNA synthesized after transcription process undergoes translation to synthesize proteins. The…
Q: The coding strand has the following sequence. Please answer the questions below with regard to this…
A: The coding strands run in 3' to 5' direction and has codons it is transcribed as it is in the mRNA…
Q: If the template strand of DNA has the sequence 5'AATGCCTATA3', the MRNA sequence that is transcribed…
A: Transcription is the first of several steps in gene expression in which a particular segment of DNA…
Q: b) What is the MRNA sequence that would be created from the DNA template sequence above?…
A: Cell is the basic structural and functional unit of life. All the cells contains the nucleus with…
Q: The template strand of DNA is 3’AGGATGCACGTAC5’ The sequence of the mRNA that is made from this DNA…
A: The RNA sequence would be same as coding strand (except thiamine is replaced by uracil) and opposite…
Q: The dna is CAT CCA ACC ATA CCC CTA TAC CCA TAT CCT CCC ATT AAA CCG what is the mRNA and A.A.?
A: Thank you for the question Answer :- The process of conversion of DNA to mRNA is called as…
Q: The following DNA strand is the CODING strand. What is the sequence of the RNA which is transcribed…
A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…
Q: Which of the following is the MRNA coding for the peptide trp-met-gly- ser-his? A.…
A: The genetic codes are the sequence of nucleotide that governs the formation of proteins.
Q: (a.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATTCCTGCCAT…
A: Introduction :- Mutations are the hereditary changes that occurs in the Genetic material (DNA) of…
Q: What is the correct tRNA anti-codon sequence for the AUG mRNA sequences? a. UGA b. UAC c. CAU d.…
A: Transfer RNA (tRNA) is a small RNA molecule that plays a key role in protein synthesis.
Q: The following diagram illustrates a step in the process of translation. Identify the following…
A: The translation is a process through which the mRNA, transcribed from the template strand of the…
Q: Some events that take place in proteins synthesis are shown below: A. An enzyme reads the gene…
A: TRANSCRIPTION It is the process of transfer of sequence information from DNA to RNA . The DNA…
Q: The sequence of bases in a sample of MRNA was found to be: GGU,AAU,CCU,UU0,GUU,ACU,CAU,UGU a Deduce…
A: mRNA is messenger RNA which is produced as a result of transcription from DNA. RNA polymerase…
Q: Which of the following describes the effect of a frameshift mutations? * A. all mRNA codons change…
A: Cental dogma is the process via which DNA is transcribed into mRNA then the mRNA is translated to…
Q: For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: b) the sequence of the…
A: The given DNA sequence is as follows 3’–CGATACGGCTATGCCGGCATT–5' The above given strand is a…
Q: The sequence A is read by RNA polymerase to produce an mRNA that is translated by the ribosome:…
A:
Q: I. List the sequences of RNA that would be transcribed from the following DNA template sequences. а.…
A: Transcription is the initial stage in gene expression, when genetic information is utilised to build…
Q: Which two sequences shown in the diagram are NOT directly transcribed from the template strand of…
A: ANSWER - in this figure the following sequences are not directly transcribed from the template…
Q: As a general rule, the first codon on a the DNA template strand thatsignals the start for a protein…
A: A codon is a trinucleotide sequence of DNA ( Deoxyribonucleic acid) or mRNA (messenger RNA) that…
Q: The sequence of mRNA made using the DNA double helix shown below is (Select ] The sequence of…
A: Introduction Protein synthesis is a two step process. In the first step, a molecule of mRNA is…
Q: Which of the following mutations of the DNA sequence TTT TÁC ÁCT would potentially have the least…
A: The genetic information from the DNA is first transcribed into mRNA. The mRNA contains codons, which…
Q: Which structure is responsible for translating MRNA? O a. RNA Polymerase II O b. RNA polymerase I O…
A: Introduction Messenger ribonucleic acid (mRNA) is a single-stranded RNA molecule that corresponds to…
Q: From TAC CTA CTC TAG TTA ACC ACA GTT GCC ATC. Translate the mRNA sequence.
A: The givem template sequence is as follows, TAC CTA CTC TAG TTA ACC ACA GTT GCC ATC Template strand…
Q: Explain (in one or two lines) the function of the followings:(a) Promoter(b) tRNA(c) Exons
A: The process of DNA based gene expression in which a particular sequence of DNA molecules are copied…
Q: Given the sequence of the DNA template GTCATG. What would be the mRNA.
A: mRNA sequence for GTCATG will be CAGUAC .
Q: Which of the following is a function of the 7-methylguanosine cap? a. Exit of mRNA from the nucleus…
A: RNA is the nucleic acids similar to the DNA and contains uracil instead of the thymine. It plays…
Q: All of the following are directly involved in translation excepta) promoter. b) ribosome.…
A: Introduction: The chemical nature of genes, such as genetic information encoding, gene expression,…
Q: Given the following DNA sequence from the template strand of a given gene:…
A: Codon is a sequence of three nucleotides which together form a unit of genetic code in a DNA or RNA…
Q: (a) Write the complementary base sequence for the matching strand in the DNA section shown below:.…
A: Introduction According to Chargaff's rules, DNA from any cell of any organism should have a 1:1…
Q: how does the E.coli ribosome find the RNA to be translated? A. the sigma factor B. the shine-…
A: SHINE DALGARNO SEQUENCE The ribosome binds to the ribosomal binding site present on messenger RNA in…
Q: What happens immediately after the initiation complex forms during translation? (a) peptide bond…
A: Translation is biological process which involves protein synthesis with the help of mRNA i.e.…
Q: The following diagram illustrates a step in the process of translation. Identify the following…
A: The translation of m RNA to peptides occurs in the ribosomes. there are three different sites…
Q: If a DNA sequence , 3' TAC AAT GAA 5' , is the template for transcription, the resulting mRNA would…
A: CENTRAL DOGMA:- The whole process of Central Dogma involves two processes:- 1) When DNA changes into…
Q: Which mutation changes a normal codon to another codon specifying the same amino acid a. directed b.…
A: Any change in the base pair of the sequence of base pairs that are present in the nucleic acid…
Q: Which mutation changes a normal codon to another codon specifying the same amino acid a. directed b.…
A: In missense mutation codon for an amino acid gets replaced. Then option b is wrong.
Q: A fragment of bacterial DNA reads: 3’ –TACCTATAATCTCAATTGATAGAAGCACTCTAC– 5’ Assuming that this…
A: During transcription, DNA information is transcribed into messenger RNA, which is then used to…
Q: Which two of the following statements about transcription are true A. Transcription makes an RNA…
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: At the DNA level, a mutation in a protein coding region where a single base is replaced by another…
A: Mutation is the abrupt change that occurs in the sequence of DNA resulting In altered phenotype.…
Q: If a sequence of mRNA is CUG AGU GCA, which of the following is the DNA segment from which it was…
A: DNA sequencing is defined as the way of determining the sequence of nucleic acid by identifying the…
Q: The following diagram illustrates a step in the process of translation. Identify the following…
A: Translation is the process of formation of protein from mRNA As in the question above start codon is…
Q: Below is a representation of a pre-mRNA. Numbers represent exons, and letters represent introns:…
A: Transcription is a process through which the doucle stranded DNA transcribes itself into a single…
Q: The following diagram illustrates a step in the process of translation. Identify the following…
A: The diagram illustrates the process of elongation of polypeptide chain by adding amino acids one by…
Q: Define the following terms: a. transcript b. proteome c. metabolome d. double helix e. base stacking
A: The DNA is the genetic material in the cell, which has a double helix configuration and these…
List the sequences of the mRNA molecules transcribed from the
following template DNA sequences:
a. T G A A C T A C G G T A C C A T A C
b. G C A C T A A A G A T C
Step by step
Solved in 2 steps
- Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’ 1. If the above DNA strand is the template (antisense) strand and the DNA molecule is transcribed, what is the correct nucleotide sequence and direction of the RNA formed after transcription?Shown below is a hypothetical RNA molecule. Which of the following corresponds to the template DNA used to synthesize this RNA? RNA: 5’ – A A U A U G G C G A U A U G C G G C C A – 3’ 5' - T G G C C G C A T A T C G C C A T A T T - 3' 5' - T T A T A C C G C T A T A C G C C G G T - 3' 5' - U U A U A C C G C U A U A C G C C G G U - 3' 5' - U G G C C G C A U A U C G C C A U A U U - 3'Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotidesequences (all belong to an exon):5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’ 1. If the above DNA strand is the template (antisense) strand and the DNA molecule is transcribed that produced a functional mRNA. Assuming there are no mutations, the said mRNA is then brought to the site of protein synthesis,a. what would be the amino acid sequence of the synthesized polypeptide chain?b. how many possible kinds of tRNA molecule that will bring the 2nd amino acid observing wobble hypothesis? List down their anticodons.
- Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’1. If the above DNA strand is the coding (sense) strand and the DNA molecule is transcribed, what is the correct nucleotide sequence and direction of the RNA formed after transcription?Which of the following represents the sequence of an RNA transcript for which the coding strand (also known as non-template strand) of DNA has the sequence: GTACTGGCTAGCTGCTAGAA? Note all sequences are written 5'-3'. OA. AAGAUCGUCGAUCGGUCAUG OB. AAGATCGTCGATCGG TCATG OC. GTACTGGC TAGCTGC TAGAA OD. GUACUGGCUAGCUGCUAGAAthank you
- Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain, identifying the codons, anticodons, and amino acid sequence. DNA: C G A T A C A A T G G A C C C G G T A T G C G A T A T C C mRNA: G C U A U G U U A C C U G G G C C A U A C G C U A U A G G Codon: Anitcodon: Amino Acids:B. Below is a short segment of a DNA molecule. Transcribed the DNA codon into mRNA. Use your data sheet to find the sequence of the amino acids coded for. T A C C A T G A G A A T T G T G G T C A C C T T T T T – sense strand A T G G T A C T C T T A A C A C C A G T G G A A A A A – antisense strand mRNA: Amino acid: Question: 1. If the nucleotide at position 23 in the first strand of DNA is changed to "A", what effect would this have on the protein produced?A mRNA sequence is shown below. Note that the coding strand of DNA has the same sequence as the mRNA, except that there are U’s in the mRNA where there are T’s in the DNA. The first triplet of nucleotides AAU (underlined) is in frame for coding, and encodes Asparagine. 45 50 55 60 65 5’—A A C G A A U C G U C G C C A A C U A A G A G –-3’ Which of the following DNA mutations is almost certain to result in a shorter than normal protein? at position 56 a change from G to C an insertion of a G after the G at position 56 inversion of region 56-59 (G C C A) an delete the C at position 52 None of the above.
- Use a codon chart determine the amino acid sequence. Remember to read through the strand and ONLY start after the promoter and STOP when it tells you to stop. Follow example below: Example: DNA AGA TATA TAC CTC CGG TGG GTG CTT GTC TGT ATC CTT CTC AGT ATC MRNA O protein AUG GAG GCC ACC CAC GAA CAG ACA UAG GAA GAG UCA UAG start-glu-ala-thre-hist - asp-glu-threo-stop met DNA CCT ATA TAC ACA CGG AGG GTA CGC TAT TCT ATG ATT ACA CGG TTG CGA TCC ATA ATC mRNA DGGA UAU) AUG uGul Gcc nccl cAul GCol protein ly Tur MeT cys AlA ser HIJ Ala 2 3 4 DNA AGA ACT ATA TAC CTC TTA ACA CTC TAA AGA CCA GCA CTC CGA TGA ACT GGA GCA mRNA protein DNA TAT ATAC CTT GGG GAA TAT ACA CGC TGG CTT CGA TGA ATC CGT ACG GTA CTC GCC ATC mRNA protein D DNA TAA ACT ATA TAC CTA GCT TAG ATC TAA TTA CCC ATC mRNA protein Auu UGA UAU AGU GAUCGA AUC MAG Auu AAU leu Stop. TRY-Met-Asp- ARG-Isle-Stop-Ile. Asn DNA CTA TTT ATA TAC TAG AGC GAA TAG AAA CTT ATC ATC mRNA protein D DNA CAT ATA TAC CTT AGT TAT CCA TTG ACT CGA ATT GTG CGC TTG…A small section of a gene for a protein has the following nucleotide sequence: TAT CTG GCT GTC CAAWhich of the following mutations would cause a missense mutation in the sequence shown above? Select one: a. Replacement of second thymine base with cytosine base b. Replacement of second guanine base with thymine base c. Replacement of last adenine base with guanine base d. Replacement of first guanine base with adenine baseUsing the table of genetic code, choose the CORRECT protein sequence that will be produced from the following sense strand of DNA: 5'-AUG UCU GAC UAG TTG GAT CCC - 3' Second position First position (5' end) Third position (3' end) Phe Ser Tyr Cys U Phe Ser Тут Cys Leu Ser Stop Stop A. Leu Ser Stop Trp Leu Pro His Arg Leu Pro His Arg Leu Pro Gln Arg Leu Pro Gln Arg Ile Thr Asn Ser U Ile Thr Asn Ser Ile Thr Lys Arg A Met Thr Lys Arg Val Ala Asp Gly U Val Ala Asp Gly C Val Ala Glu Gly A Val Ala Glu Gly O a. Lys-His-Ala-Gly-Asn-Leu-Val O b. Val-Val-Ser-Pro-Leu-Asp-Thr