The following DNA strand is the CODING strand. What is the sequence of the RNA which is transcribed from it? 5' ATTCTCCTAGGATTACGC 3' a. 5' ATT CTC CTA GGA TTA CGC 3' b. 5' AUU CUC CỦA GGA UUA CGC 3' c. 5' UAA GAG GAU CCU AAU GCG 3' d. 5' GCG UAA UCC UAG GAG AAU 3'

The following DNA strand is the CODING strand. What is the sequence of the RNA which is transcribed from it? 5' ATTCTCCTAGGATTACGC 3' a. 5' ATT CTC CTA GGA TTA CGC 3' b. 5' AUU CUC CỦA GGA UUA CGC 3' c. 5' UAA GAG GAU CCU AAU GCG 3' d. 5' GCG UAA UCC UAG GAG AAU 3'

Name: The following DNA strand is the CODINGstrand. What is the sequence of
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: The following DNA strand is the CODINGstrand. What is the sequence of the RNAwhich is transcribed from it?5' ATTCTCCTAGGATTACGC 3'a. 5' ATT CTC CTA GGA TTA CGC 3'b. 5' AUU CUC CỦA GGA UUA CGC 3'c. 5' UAA GAG GAU CCU AAU GCG 3'd. 5' GCG UAA UCC UAG G

BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)

10th Edition

ISBN:9781305967359

Author:STARR

Publisher:STARR

Chapter9: From Dna To Protein

Section: Chapter Questions

Problem 16SA

See similar textbooks

Similar questions

The diagram shows a double-stranded section of DNA. Identify the site of transcription initiation on the template strand for this gene. A B 5' 3' 0000 RNA polymerase A B C D ATG C D 3' 5'
DNA 3’ AGA ACA TAA TAC CTC TTA ACA CTC TAA AGA CCA GCA ATT CGA TGA ACT GGA GCA 5’ mRNA protein
A DNA antisense strand contains the following nucleotide base sequence:CGA TTT GGT TGAFrom this, what is the nucleotide sequence of the mRNA strand that is transcribed? a. CGA UUU GGU UGA b. GCU AAA CCA ACU c. GCA AAA CCA ACT d. CGA TTT CCA ACT
Given Sequence: 5’ – TCAGGACTGATAGGCTAATCGGCCCGCGCACAT-3’ a. Complementary Strand b. Direct Transcript c. Transcript for Translation d. Amino Acid Sequence or Translation:
Give only typing answer with explanation and conclusion which of these choices represents one possible corresponding mRNA sequence that can be transcribed by RNA polymerase, and later translated by ribosomes from the following DNA template? 5'- CTGTATCCTAGCACCCAAATCGCAT - 3'; A. 5'- CTA GCA CCC AAA TCG CAT TAG - 3', B. 5' - AUG CGA UUU GGG UGC UAG - 3', C. 5' - AUG CGA UUU GGG UGC - 3', D. 5- ATG CGA TTT GGG TCG TAG - 3'
What is the RNA transcript that would result from the double stranded DNA segment shown below? 5'-GCACGTTGGTCGATCACGTAATATACGCATCGACTCCCGATCGA-3' 3'-CGTGCAACCAGCTAGTGCATTATATGCGTAGCTGAGGGCTAGCT-5' 5'- ين
The partial sequence of a gene Question 2 coding strand is: 5'-TACGATCATAT-3. This sequence is transcribed. What is the sequence of the corresponding RNA? A 5'-UACGAUCAUAU-3’ B 5'-ATATGATCGTA -3’ C 5'-AUGCUAGUAUA-3’ D 5'-AUAUGAUCGUA-5’ E 5'-TATACTAGCAT-3’
Refer to the DNA template strand below. Which of the following corresponds to the protein coding sequence portion of the corresponding mRNA? 5' - CTGTATCCTAGCACCCAAATCGCATTAGGAC - 3' O 5'- ATG CGA TTT GGG TGC TAG - 3' O 5' - AUG CGA UUU GGG UGC - 3' O 3' - GAC AUA GGA UCG UGG GUU UAG - 5' O 5' - CTA GCA CCC AAA TCG CAT TAG - 3' O 3' - GGA CAU AGG UAC GUG GGU UUA GCG UAA UCC UG - 5'
What is the base sequence of a mRNA strand that is complementary to the DNA sequence 5'-ATCGGATTC-3' sequence? a5'-ATCGGATTC-3' b5'-GAAUCCGAU-3' c5'-GAATCCGAT-3' d5'-UAGCCUAAG-3'
A template DNA strand for transcription is 5' - GAG GTG AAA - 3' What is the resulting RNA sequence (with correct orientation)? O 5'- GAG GTG AAA - 3' Q5' - AAA GTG GAG - 3' 3' - UUU CAC CỤC - 3' 3' - CUC CAC UUU - 5' O glu - val - lys
A DNA antisense strand contains the following nucleotide base sequence: ACG TTT ATG GGT From this, what is the nucleotide sequence of the MRNA strand that is transcribed? a. TGC AAA TAC CCA b. UGC AAA UAC CCA C. AGC UUU AUC CCU d. ACG UUU AUG GGU
A segment of a protein-encoding gene sequence is given below. 5’-AAGTTTGGCACT-3’ 3’-TTCAAACCGTGA-5’ What is the RNA sequence that would be transcribed off of the bottom strand?