Question 2 coding strand is: 5'-TACGATCATAT-3’. This sequence is transcribed. What is the sequence of the corresponding RNA? The partial sequence of a gene |A 5'-UACGAUCAUAU-3’ B 5'-ATATGATCGTA -3' C 5'-AUGCUAGUAUA-3’ D 5'-AUAUGAUCGUA-5' E 5'-TATACTAGCAT-3’
Q: QUESTION 13 Part of the sequence of a prokaryotic gene, including the translational start site, is…
A: DNA is a double helical structure with two helices bounded to each other. One strand is template and…
Q: QUESTION 31 Written from 5' to 3', the sequence of an RNA molecule made using the top strand of DNA…
A: INTRODUCTION Transcription is the process of making an RNA copy of a gene sequence. This copy,…
Q: QUESTION 21 You have the following coding sequence for a gene and need to generate billions of…
A: Polymerase chain reaction (PCR) is a fast in vitro method to amplify a given DNA sequence present in…
Q: Question 26 The initial event in the conversion of an hnRNA to the mature RNA which leaves the…
A: Answer is D
Q: QUESTION 12 The images shown depict the initiation and elongation steps in protein translation. P.…
A:
Q: What is a promoter? a The site where the ribosome begins translation b The site where RNA…
A: Promoter: - Cis-acting (means non-coding gene) - Position dependent - Orientation dependent
Q: QUESTION NO. 1 Fragile X syndrome is a common form of inherited mental retardation. The mutation in…
A: Since you have asked multiple question, we will solve the first question for you. If youwant any…
Q: Question 8 The unique stem-loop structures of the transfer RNA helps the RNA perform its function of…
A: tRNA (Transfer ribonucleic acid) is one type of RNA that is used in translation machineri to decode…
Q: QUESTION 4 Which type of mutation will affect not only the amino acid encoded by the affected codon,…
A: Frameshift mutation can change every amino acid after the point of mutation . It caused by deletion…
Q: Which of the following best explains why there are 64 codons, but only20 amino acids for which they…
A: BASIC INFORMATION TRANSLATION It is the process in which protein is which formed from the…
Q: Question 24 Tryptophan-repressor complex binds to operator O Gene is switched ON Gene is switched…
A: Tryptophan operon is a biosynthetic process in Ecoli in which group of genes that is associated with…
Q: Where does transcription occur in eukaryotic cells? a in the nucleus b in the cytoplasm c…
A: Transcription is the first step in protein synthesis and this process is responsible for mRNA…
Q: QUESTION 22 If polynucleotide phosphorylase (PNP) synthesizes random RNA when given a 50-50 mixture…
A: Codons are trinucleotide bases of DNA or RNA that code for specific amino acids. There are 64 codons…
Q: QUESTION 5 the heteroduplex region is a region that O any DNA that is double stranded O DNA contains…
A: Introduction: Recombination is the process in which there occurs physical exchange of the sequence…
Q: QUESTION 2 In order to compare transcript A and B expression levels in the same libarary based on…
A: Hi! Since you have posted multiple questions we will answer the first one for you. Please repost the…
Q: Question 16 All of these can be gene products except A tRNA B proteins (c) dsDNA D) FRNA E) MRNA
A: A gene product is the biological substance produced by the expression of a gene, which might be RNA…
Q: Question 9 How many amino acids are found in the polypeptide when the MRNA is translated? MRNA 5…
A: Genetic code The relationship between the sequence of amino acids in a polypeptide chain and…
Q: Which of the following is not part of pre-mRNA processing in eukaryotes?
A: pre-mRNA processing is the process of converting a pre-mRNA into a functional mRNA that participates…
Q: Question 22 During RNA chain elongation gyrase proceeds ahead of the transcription bubble in order…
A: DNA gyrase does the indispensable job of catalyzing the ATP dependent negative supercoiling of…
Q: Question 15 The higher protein abundance observed in the ACE20E allele compared to the wild- type…
A: Introduction The expression of genes is highly regulated in both prokaryotes as well as in…
Q: Question 6 the following DNA strand 5'-AACGATCATAT- 3' is: The complementary strand of |A…
A: Double stranded DNA is complementary to each other. This complementarity is governed by…
Q: Question 23 All may be RNA polymerase Il promoter constituents EXCEPT: A the core element where…
A: Transcription is the process by which RNA is produced from the DNA template. This process occurs…
Q: Question 6 In eukaryotic transcription, both introns and exons are transcribed. A) True B) False
A: INTRODUCTION It is an process of transcription in the formation of a DNA strand is mainly copied…
Q: QUESTION 4 In eukaryotes, exons are O 1. spliced out of the original transcript. O 2. spliced…
A: DNA (deoxyribonucleic acid) is the genetic material of all the organisms on the planet except a few…
Q: Question 12 Which of the following best describes the assembly process to initiate translation in…
A: Introduction Translation is the process by which ribosomes in the cytoplasm or endoplasmic reticulum…
Q: Question 93 Bonus: CRISPR-Cas 9 originally evolved as part of bacterial "immune response" against. O…
A: The CRISPR-Cas system is an immune system found in prokaryotes that provide resistance to foreign…
Q: QUESTION 9 In a lab, researchers induced a mutation to the Gal3 gene in yeast. The original sequence…
A: Abrupt changes in the DNA sequences are called mutations. these may or may not change the protein…
Q: Question 41 Elongation factor Tu (EF-Tu): A binds initiator tRNA and GTP. binds aminoacyl-tRNA in…
A: The synthesis of protein by using the information present in the mRNA is known as translation. The…
Q: QUESTION 20 Which of the following polymerases is found in the nucleolus? O A. DNA polymerase III O…
A: Polymerase enzyme is responsible for the process of polymerizing the monomers into polymers.
Q: QUESTION 19 A mutation inserts one nucleotide pair in the center of the open reading frame of a…
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: Question 26 hich of the following best describes the assembly process to initiate translation in…
A: Translation is defined as the process of synthesising of protein from the mRNA. It takes place in…
Q: Question 23 Repressor protein binding at DNA upstream O Gene is switched ON Gene is switched OFF…
A: The repressor is a small protein molecule that acts as the binding protein which inhibits the…
Q: QUESTION 17 Which of the following best supports the idea that the genetic code is composed of…
A: mRNA is produced by the process of transcription by action of RNA polymerase.
Q: QUESTION 1 Human ribosomes can translate the SARS-COV2 genome because: O it is reverse transcribed…
A: COVID 19 (Coronavirus disease 2019) is a pandemic disease that is caused by air-borne Severe acute…
Q: QUESTION 8 Why did you bother to identify the introns? O So that I could include them in the…
A: Introduction Introns This is a nucleotide sequence in the gene that removed by RNA splicing during…
Q: Question 10 The following statements best describes the RNA structure EXCEPT some eukaryotic RNAS…
A: RNA is produced from the DNA sequence by the transcription process in the nucleus of eukaryotic…
Q: Question 20 The initiation factors form a complex with RNA polymerase O Gene is switched ON O Gene…
A: The initiation factor form a complex with RNA polymerase when gene is switched on . when the gene is…
Q: QUESTION NO. 1 Antisense nucleic acids A. complementary to mRNA would enhance translation . B.…
A: Replication is considered as a process, in which new strand is synthesized over the template strand.…
Q: QUESTION 5 Genomic equivalence means that: O A. all related species share the same set of genes O B.…
A: Dolly is a transgenic sheep produced by fusing a mammary gland cell nucleus with an enucleated…
Q: QUESTION 11 Which of the following statements about RNA interference pathways and mechanisms is…
A: Small interfering RNA are small, double stranded RNA molecules that may bind with the target…
Q: QUESTION 6 The complementary sequence of 5' AATTCGOCTTA 3' is (note the polarity 5' and 3 of the DNA…
A: A DNA molecule is a double helix that has two anti-parallel strands intertwined with each other…
Q: Question 25 Which of the following RNAS is the product of transcription? A MRNA and tRNA only B FRNA…
A: Answer: D) mRNA, tRNA and rRNA. The product of DNA transcription is RNA it can be in the form of…
Q: Question 13 of 13 DNA A= 5' GGG GCT AGC CCC 3' DNA B= 3' ATA TAT ATA CCC 5' DNA C= 5' TAC GTT ACG…
A: DNA has two antiparallel strands of which one runs in 5'-3' direction and other in 3'-5' direction.…
Q: QUESTION 7 SR proteins bind to splicing enhancers and activate splicing by recruiting spliceosome…
A: SR proteins hepls in pre mRNA splicing. SR protein has two binding domain. RNA recognition motif…
Q: Question 1: The diagram below depicts an eukaryotic gene. In which region would the insertion of a…
A: A particular gene is transcribed into RNA by the process known as transcription and that RNA is…
Q: Which of the following best explains why each codon only codes for a very specific amino acid?…
A: The genetic codon is composed of three successive nucleotides present on the mRNA and the genetic…
Q: Which of the following best explains why there are 64 codons, but only20 amino acids for which they…
A: Which of the following best explains why there are 64 codons, but only20 amino acids for which they…
Q: Question 12 Alternative splicing A. happens when different set of exons are joined together B.…
A: Option d A,C,D,E
Q: Part A How can an isolated DNA bind to DNA on a column? What property allows the column to do this?…
A: DNA extraction/isolation is used for various biotechnological and microbiological studies. It is a…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- The DNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using this sequence, write the sequence of the polypeptide that results from this gene. Be sure to appropriately label the ends of the molecule. 5'-ATGCACGGCGACTAG-3' Second letter A UAU Tyr UAC First letter U A G U UUU1 UUC UUA LOU Leu CUU CUC CUA CUG Phe GUU GUC GUA GUG Leu AUU AUC lle AUA AUG Met Val C UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala CAU His CAC CAA CAG Gin AAU Asn AAC AAA 1 Lys AAG LYS G {}a UAA Stop UGA Stop A UAG Stop UGG Trp GAU 1 GAC Asp GAA GIU Glu GAGJ UGU UGC CGU CGC CGA CGG AGU AGC AGA AGG Cys GGU GGC GGA GGG Arg Ser Arg DOA DOA DOA DUTO Third letter GlyGive the RNA molecule sequence transcribed from the following DNA sequence of a eukaryotic gene and with the correct 5' and 3' ends. DNA: 5'-ATAGGGCATGT-3' 3'-TATCCCGTACA-5' <--- template strand Group of answer choices 5'-ATAGGGCATGT-3' 3'-UAUCCCGUACA-5' 5'-AUAGGGCAUGU-3' 3'-TATCCCGTACA-5'Answer the following whether it is TRUE or FALSE: 1. For each DNA segment 3'-ACCTGCCTACCCG-5' the sequence of the mRNA molecule synthesized is 5'-TGGACGGATGGGC-3' 2. In the template strand TACCGAGGTATGTAC, the coding strand is 5'-ATGGCTCCATACATG-3'. 3. In the template strand TACCGAGGTATGTAC, the coding strand is 5'-AUGGCUCCAUACAUG-3'. 4. The template strand is the strand of DNA used for RNA synthesis. 5. Transcription forms a messenger RNA molecule with a sequence that is identical to the DNA template from which it is prepared.
- The following sequence represents the dsDNA code for a short peptide 5' -CTT TCC CAT CAC CGC ATG CAT CCT CCC TCC TTT CTT TAA TAT TGG-3' 3'-GAA AGG GTA GTG GCG TAC GTA GGA GGG ACC AAA GAA ATT ATA ACC-5' Transcribe the DNA strand given above to write the sequence of the mRNA strand in the 5’ to 3’ direction. (1) Use the table and write the sequence of the resulting peptide. (1) Is it possible for a codon to code for another amino acid? (1) What will be the effect if a mutation changes the codon UAU to UAA? (1) What is a reading frame? (1) If you are given a nucleotide sequence, how would you find Open Reading Frames? (1) DISCUSS the reason why there are leading and lagging strands in replication?The BNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using this sequence, write the sequence of the polypeptide that results from this gene. Be sure to appropriately label the ends of the molecule. 5'-ATGCACGGCGACTAG-3' Second letter A UAU Tyr UAC First letter U P с > < A G U UUU UUC Phe UUA UUG CUU CUC CUA CUG L GUU GUC GUA GUG Leu Leu AUU AUC lle AUA AUG Met Val C UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala Cys UAA Stop UGA Stop A Trp UAG Stop UGG CAC His CGU J CGC CAA I CGA Gin CAGG CGG AAA 1 AAG Lys UGU UGC AAU Asn AGC} AAC GAC Asp GAA GAGGIU For the toolbar, press ALT+F10 (PC) or ALT+FN+F10 (Mac). BIUS Paragraph V Arial G 1 AGA 1 AGG GGU GGC GGA GGG Arg Ser Arg Gly V DCAG DCA DOA UCAG Third letter 10pt < Av V IX Q ... O WORDS POWERED BY TINYThe sequence below is of the DNA duplex for a gene in which transcription begins with the nucleotide highlighted by the arrow. If the upper strand shown is the template strand, write the sequence you expect for the mRNA transcribed from this gene. Please write 5' to 3'. 5'-[x]-3' 5'-TACGTGACGGTAATACTAGC-3' 3'-ATGCACTGCCATTATGATCG-5'
- The following segment of DNA is part of the RNA-coding sequence of a transcription unit. If the bottom strand is template, which of the following RNA sequences would be transcribed? DNA: 5-'ATAGGCGATGCCA-3' 3'-TATCCGCTACGGT-5' O 5'-UAUCCGCUACGGU-3' O 5'-ACCGUAGCGGAUA-3' O 5'-AUAGGCGAUGCCA-3' O 5'-UGGCAUCGCCUAU-3'Here is the nucleotide sequence of an imaginary strand of DNA: 5’ AATTGGCCATGC 3’. If this strand of DNA was transcribed, the resulting messenger mRNA molecule would be: Met-Val-Tyr-Lys 3’ TACGTACG 5’ 3’ TTAACCGGTACG 5’ 3’ UUAACCGGUACG 5’17) Synthesis of the mRNA starts at the boxed A/T base pair indicated by the box and proceeds left to right on the sequence below. Transcribe and translate this bacterial gene. 5'-GGACCGCGGGGCAGGATTGCTCCGGGCTGTTTCATGACTIGICAGGTGGGATGACTTGGATGGAAAAGTAGAAGGTCATG-3 3'-CCTGGCGCCCCGTCCTAACGAGGCCCGACAAAGTACTGAACAGTCCACCCTACTGAACCTACCTTTTCATCTTCCAGTAC-5′ 1 -+--at - --+-- 80
- The sequence of part of an mRNA transcript is What is the sequence of the DNA coding strand? 5'- 5' - AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG - 3' 5'- ATGGGGAACAGCAAGAGTGGGGCCCTGTCCAAGGAG What is the sequence of the DNA template strand? TACCCCTTGTCGTTCTCACCCCGGGACAGGTTCCTC Incorrect -3' -3'Given the DNA sequence below: 5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’ 3’-TGTACACATGTCCGAAACAGACTTACCGAA-5’ Transcribe the gene. (Write the primary structure of the mRNA that will be produced.)3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Make vertical lines between codons to make this assignment easier to do. Which strand is the template strand? The first strand is the template strand as it going 3-5 Copy the template strand in mRNA. Label the 5’ and 3’ ends. 5' AUG UUA CCC GCU GCG CGA AGC AAA GUC UAA 3” Write out the amino acid (you can use the short form) that this protein would be made of (keep in mind proteins are usually a minimum of 50 proteins. Met-Leu-Pro-Ala-Ala-Arg-Ser-Lys-Val What do you notice about the mRNA strand compared to the non template strand of DNA? 2. What amino acid does the second codon code for on the DNA template strand? ______Assume the 6th amino acid in the strand is changed from a T to a C. What amino acid does it code for now? _______ What type of mutation is this? 3. Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would…