Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom: 5'-ATGCTGCGTGCATGGGATATAGGTAGCACACGTCC-3' 3'-TACGACGCACGTACCC TATATCC ATCGTGTGCAGG-5' (a) Assuming that transcription starts with the first C in the template strand, and continues to the end, what would be the sequence of the MRNA derived from this fragment? (b) Find the initiation and stop codons in this mRNA. (c) Would there be an effect on translation of changing the fourth T in the template strand to a C? If so, what effect? (d) Would there be an effect on translation of changing the fourth A in the template strand to a C? If so, what effect? AGA UUA UUG CUA AUA CUC GCA CGA GUA GUC ACA UAA UAG UGA UUC CCG ACG GCU CGU GAU AAU UGU GAG CAG GGU CAU AUU CUU AAG AUG UUU CCU UCU ACU UGG UAU GUU Ala Arg Asp Asn Cys Glu Gin Gly His le Leu Lys Met Phe Pro Ser The Trp Tyr Val stop DNCE M FP HIL

Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom: 5'-ATGCTGCGTGCATGGGATATAGGTAGCACACGTCC-3' 3'-TACGACGCACGTACCC TATATCC ATCGTGTGCAGG-5' (a) Assuming that transcription starts with the first C in the template strand, and continues to the end, what would be the sequence of the MRNA derived from this fragment? (b) Find the initiation and stop codons in this mRNA. (c) Would there be an effect on translation of changing the fourth T in the template strand to a C? If so, what effect? (d) Would there be an effect on translation of changing the fourth A in the template strand to a C? If so, what effect? AGA UUA UUG CUA AUA CUC GCA CGA GUA GUC ACA UAA UAG UGA UUC CCG ACG GCU CGU GAU AAU UGU GAG CAG GGU CAU AUU CUU AAG AUG UUU CCU UCU ACU UGG UAU GUU Ala Arg Asp Asn Cys Glu Gin Gly His le Leu Lys Met Phe Pro Ser The Trp Tyr Val stop DNCE M FP HIL

Name: Here is the sequence of a portion of a bacterial gene. The template s
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Here is the sequence of a portion of a bacterial gene. The template strandis on the bottom:5'-ATGCTGCGTGCATGGGATATAGGTAGCACACGTCC-3'3'-TACGACGCACGTACCC TATATCC ATCGTGTGCAGG-5'(a) Assuming that transcription starts with the first C in the templatestr

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 16QP: Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also,...

See similar textbooks

Similar questions

Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:5’-ATGCTGCGTGCATGGGATATAGGTAGCACACGTCC-3’3’-TACGACGCACGTACCC TATATCC ATCGTGTGCAGG-5’(a) Assuming that transcription starts with the first C in the template strand, and continues to the end, what would be the sequence of the mRNA derived from this fragment? (b) Find the initiation and stop codons in this mRNA. (c) Would there be an effect on translation of changing the fourth T in the template strand to a C? If so, what effect? (d) Would there be an effect on translation of changing the fourth A in the template strand to a C? If so, what effect?
Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom: 5’- ATGCTGCGTGCATGGGATATAGGTAGCACACGTCC-3’ 3’-TACGACGCACGTACCC TATATCC ATCGTGTGCAGG-5’ (a) Assuming that transcription starts with the first C in the template strand, and continues to the end, what would be the sequence of the mRNA derived from this fragment?
Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom: 5’-ATGCTGCGTGCATGGGATATAGGTAGCACACGTCC-3’ 3’-TACGACGCACGTACCC TATATCC ATCGTGTGCAGG-5’ (a) Assuming that transcription starts with the first C in the template strand, and continues to the end, what would be the sequence of the mRNA derived from this fragment? (b) Find the initiation and stop codons in this mRNA
Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom: 5’-ATGCTGCGTGCATGGGATATAGGTAGCACACGTCC-3’ 3’-TACGACGCACGTACCC TATATCC ATCGTGTGCAGG-5’ Assuming that transcription starts with the first C in the template strand, and continues to the end, what would be the sequence of the mRNA derived from this fragment? Q) Would there be an effect on translation of changing the fourthT in the template strand to a C? If so, what effect?
For this double stranded DNA: 3’-AGGTCCAGTCTTCGGCGGATGATCGGGCCAACCCCCGTAACTGGTCACCGGAATGCC-5’ 5’-TCCAGGTCAGAAGCCGCCTACTAGCCCGGTTGGGGGCATTGACCAGTGGCCTTACGG -3’ , while using the bottom strand is the template for transcription. If the START CODON is AUG and the STOP CODON IS UGA, how many amino acids are in the encoded protein and what is the primary structure?
For this double stranded DNA: 3’-AGGTCCAGTCTTCGGCGGATGATCGGGCCAACCCCCGTAACTGGTCACCGGAATGCC-5’ 5’-TCCAGGTCAGAAGCCGCCTACTAGCCCGGTTGGGGGCATTGACCAGTGGCCTTACGG -3’ , while using the bottom strand is the template for transcription. If the START CODON is AUG and the STOP CODON IS UGA, what would it look like drawn out?
The following segment of DNA is part of the RNA-coding sequence of a transcription unit. If the bottom strand is template, which of the following RNA sequences would be transcribed? DNA: 5-'ATAGGCGATGCCA-3' 3'-TATCCGCTACGGT-5' O 5'-UAUCCGCUACGGU-3' O 5'-ACCGUAGCGGAUA-3' O 5'-AUAGGCGAUGCCA-3' O 5'-UGGCAUCGCCUAU-3'
Consider the following DNA template: 5’-AAGAGGTTCCAATGCAGGCACTCACCAACTCTTAAATAAA-3’ 3’-TTCTCCAAGGTTACGTCCGTGAGTGGTTGAGAATTTATTT-5’ If the bottom DNA strand is used as template to transcribe mRNA, predict the amino acid sequence that would result from the process of translation. Met-Ala-Leu-Thr-Gln-Glu-Gly Met-Gly-Ser-Leu-Asn-Ser-Gln Met-Thr-Asn-Ser-Leu-Ala-Gln Met-Gln-Ala-Leu-Thr-Asn-Ser Met-Glu-Ala-His-Trp-Ser-Tyr
The sequence below is of the DNA duplex for a gene in which transcription begins with the nucleotide highlighted by the arrow. If the upper strand shown is the template strand, write the sequence you expect for the mRNA transcribed from this gene. Please write 5' to 3'. 5'-[x]-3' 5'-TACGTGACGGTAATACTAGC-3' 3'-ATGCACTGCCATTATGATCG-5'
Below is the double stranded DNA sequence of part of a hypothetical yeast genome encoding a very small gene. Transcription starts at nucleotide immediately following the promoter. The termination sequence is TATCTC. How many amino acids will this protein have? 5' TCATGAGATA GCCATGCACTA AGGCATCTGA GTTTATATCT CA 3' 3' AGTACTCTAT CGGTACGTGAT TCCGTAGACT CAAATATAGA GT 5'
b) Shown below is a very short gene of an unknown bacteria genome (Figure 2). Transcription starts at Transcription Start Site (TSS) and terminates at the Terminator site. TSS 5'TATTATTAACGCATGACGAGCCATGCATTATCGGTATATGCACTGACCCGGRAAGGCTCCTTTTGGAGCCTTTTTT-3' 3' ATAATATTGCGTACTGCTCGGTACGTAATAGCCATATACGTGACTGGGCCTTTCCGAGGAAAACCTCGGAAAAA-5' Promoter Terminator Figure 2 Based on the double-stranded DNA sequence of terminator, draw the structure of hairpin loop that will be formed during transcription. Illustrate how the hairpin loop structure initiates the termination of transcription.
b) Shown below is a short gene of an unknown bacteria genome (Figure 2). (Note: Transcription starts at Transcription Start Site (TSS).) 5'TATTATAACGCATGACGAGCCATGCATTATCGGTATATGCACTGACCCGGAAAGGCTCCTTTTGGAGCCTTTTTT-3' 3'-ATAATATTGCGTACTGCTCGGTACGTAATAGCCATATACGTGACTGGGCCTTTTCCGAGGAAAACCTCGGAAAAA-5' Promoter (i) (ii) TSS (iii) Terminator Figure 2 Which DNA strand (the top or the bottom) is used by polymerase as a DNA template? List the mechanistic steps that can trigger the initiation of transcription by the Sigma Factor. What are the amino acids translated from the resulting mRNA? Indicate the amino (NH₂*) and carboxyl (COO) termini of the polypeptide chain.