1. Calculate the size of the resulting fragments as they will occur after digestion and write the sizes on the maps below. Note that linear DNA has a total size of 48 502 bp (see figure 3A).
Q: Give the base sequence of the complementary DNA strand of the DNA chain with the following base…
A: DNA is a macromolecule composed of individual subunits known as nucleotides. Each nucleotide…
Q: 9 The table opposite shows the standard riplet codes for the 20 amino acids involved in protein…
A: Transcription is the process in which the DNA strand which codes for a protein and e converted to…
Q: 1. Imagine that you are analyzing a DNA sample from the liver tissue of a newly discovered species…
A: Since you have asked multiple question, and need help in 1 & 2, we will solve the first and…
Q: E D A 11. Ligase is denoted by letter 12. The Okazaki fragment is denoted by letter . 13. The SSB…
A: DNA (Deoxyribonucleic acid) and RNA are two examples of nucleic acids (Ribonucleic acid).…
Q: 5.State the contribution of the following scientists to the understanding of DNA structure: a)Erwin…
A: Nucleic acids are present inside the nucleus to store and pass genetic information and thus control…
Q: . The following represents a DNA strand in the process of replication. The bottom sequence is that…
A: According to guidelines we have to answer the first question only. so please kindly post the…
Q: 5. Convert each of the following 3' to 5' DNA sequences to 5' to 3' DNA sequences. a. 3' ATCG 5' b.…
A: DNA contains all the genetic information of an organism in the form of genes. These genes are…
Q: #1 under Identify the Structures is what.... A. original strands of DNA B. backbone of DNA C.…
A: The deoxyribonucleic acid (DNA) is the double-stranded molecule which is the genetic material in…
Q: Discuss the reasons proteins were generally favored over DNA as the genetic material before 1940.…
A: DNA and RNA are considered as a genetic material. DNA is inherited or transferred from parents to…
Q: Write out the resulting DNA molecules after the following double stranded DNA molecule is digested…
A: DNA stands for deoxyribonucleic and. It is the genetic material present in the cell.
Q: 1. Why do we need to check the isolated DNA for its quantity and quality? 2. The purity of DNA…
A: Deoxyribonucleic acid DNA isolation is referred to the extraction process of DNA from different…
Q: Answer the following Mutated DNA Template Strand #1: 3’-T A C T G T C T G A C G A T C-5’…
A: The central dogma depicts the flow of genetic information into cells, the replication of genomic…
Q: 4. Complete the table below: RNA DNA Strand Sugar residue Nitrogenous bases Main Function
A: Nucleic acids are made up of nucleotides, which are the fundamental building blocks of DNA and RNA.…
Q: 1. During the replication of a DNA molecule, separation or "unzipping" of the DNA molecule will…
A: DNA, is generally a give a short term for deoxyribonucleic acid, is the molecule which contains the…
Q: 2. In the space below, the two parallel lines indicate a section of double-stranded DNA that is…
A: 5' - 3' direction alludes to the direction of nucleotides of a solitary strand of Deoxyribose…
Q: 2) Label the coding and the template strand in the table.
A: A G A C T T A T C T…
Q: 25.) The area indicated by the arrow is the A) sugar-phosphate backbone B) minor groove C) major…
A: Biochemistry is a branch of biology that deals with the structure, function and interaction of…
Q: Given the graph, how big would a fragment of DNA be that travelled 20mm on a gel? 10000 Boco 4000…
A: In this graph Y axis is the size of DNA fragment in base pair. And X axis is the distance travelled…
Q: 1. Below is the base sequence of protein for normal hemoglobin and the base sequence for the sickle…
A: 1. Below is the base sequence of protein for normal hemoglobin and the base sequence for the sickle…
Q: Match the label on the left with the correct structure number in the DNA molecule in the image…
A: The given structure is of a alpha helix DNA. The DNA is composed of nucleotides. Nucleotide - The…
Q: 1. Explain why DNA fragments can be separated using an electric current. How does the size of the…
A: 1.DNA fragments can be separated by the application of current this process of separating DNA occurs…
Q: 11.Fill out the following table by adding the complementary RNA and DNA basses. NA NA А G C
A: Answer: Nucleic bases are the nitrogen containing compounds such as adenine , guanine , thymine ,…
Q: Fill in the palindromic sequence of the given DNA strand containing six bases. 5' GACGTC 3' 3' _ _…
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: Write the complementary sequence for the following DNA sequence, in order from 3' to 5':…
A: Deoxyribonucleic acid (DNA) is the hereditary unit of life, which carries the genetic information in…
Q: 5. Name the five nitrogenous bases in the table below, and put an X in the correct column for each…
A: A nitrogen base, sugar molecule, and phosphate groups make a nucleotide. A nucleotide is a…
Q: 2. A. B. C. The DNA of each species has a different base composition. Find the base composition of…
A: Nucleotide subunits made up DNA's structure. Deoxyribose along with a phosphate group, and one of…
Q: 1. What is the function of DNA helicase in DNA replication? a. To create replication bubbles by…
A: Helicases are enzymes that catalyse the separation of duplex nucleic acids into single strands in an…
Q: 4. (a) Create the complementary strand for the DNA strand below. Make sure to write the direction of…
A: DNA is a polynucleotide molecule that stores genetic and hereditary information. DNA is a…
Q: Mention and explain 4 characteristics of the Structure of DNA.
A: DNA- Deoxyribose Nucleic Acid
Q: Consider the following segment of DNA:5′ GCTTCCCAA 3′3′ CGAAGGGTT 5′Assume that the top strand is…
A: Transcription is a fundamental process that occurs in our genome. It is the process of converting…
Q: 4) Repetitive DNA comprises about _________ of chromosomal DNA A) 5% B) 40% C) 60% D) 95%
A: DNA is the genetic material in most living organisms. It carries information for synthesis of all…
Q: List the complementary non-coding DNA sequence. CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCCC . . .
A: DNA consist of a double-helical structure where one strand is called a sense strand or non-coding…
Q: 4. Use the RNA strand below and list the appropriate amino acids. AUG AGU UAC CCG GGA
A: Introduction :- Organic molecules known as amino acids have side chains unique to each amino acid as…
Q: he figure shows that the average distance between base pairs measured parallel to the axis of a DNA…
A: The nucleic acid polymer has nucleotide as its monomeric unit. synthesis of nucleotides is an…
Q: 1. The following gel was produced in manual DNA sequencing. What would the unknown DNA template be…
A: The method of determining the nucleic acid sequence – the order of nucleotides in DNA – is known as…
Q: Write the base sequence in a complementary DNA segment if each original segment has the following…
A: The cell is the basic primary unit of life for all living organisms. Inside this, the nucleus is the…
Q: 1) What is the size of the following single-stranded piece of DNA? ATCGTGTGCT A) 10 b B) 20 bp C) 20…
A: According to guidelines we have to answer the first question only. so please kindly post the…
Q: 3. The data in the following table represent the base composition of two double stranded DNA sources…
A: Ervin Chargaff discovered the Base proportion in double stranded DNA. The findings in his study came…
Q: 1. Which of the following are generated due to the twisting of dsDNA? a. Hydrophobic bonds b. Van…
A: DNA acts as genetic material in most organisms. DNA is a double-helical structure in which two…
Q: (1) Describe the nitrogenous base pairing in DNA and RNA. (2) Determine the number of bonds in each…
A: DNA and RNA are polynucleotides. Monomers of nucleic acids are nucleotides. Nucleotides are made up…
Q: Figure 3: BestrictriOR site map showing the following: A) linear DNA that is not cut as reference B)…
A: Restriction enzymes cut the DNA (deoxyribonucleic acid) at specific sites. These enzymes recognize…
Q: 25.) The area indicated by the arrow is the A) sugar-phosphate backbone B) minor groove C) major…
A: Deoxy ribonucleic acid (DNA) is the genetic material that contains genetic material in the form of…
Q: 10) Which statement accurately describes DNA? A) Double Helix C) Remains in the nucleus D) All of…
A: DNA is deoxyribose nucleic acid which, and contain genes also.
Q: 6. What are the sides of the DNA ladder made of? a. b.
A: DNA or deoxyribonucleic acid is the molecule that contains genetic code of organisms. It forms a…
Q: 6. In the DNA structure below, indicate a hydrogen bond, a phosphodiester bond, a 5' phosphate and a…
A: DNA is the molecular term for the molecule in all living organisms that conveys genetic code. The…
Q: 1. Give the different hydrolytic products of : a DNA b. RNA 2. Enumerate the biological functions of…
A: The biological macromolecules that constitute a living system are : Nucleic acid (DNA and RNA),…
Q: 1. Which of the following nucleotides are the part of DNA? B) DTMP C) dUMP D) dTTP
A: We are authorized to answer one question at a time, since you have not mentioned which question you…
Q: A portion of one strand of DNA has the sequence 5′ ATTCGGTAA 3′. If this strand is used as a…
A: Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: Regarding the triple DNA code, which of the following statements is true?
A: The genetic code refers to the set of rules that all living organisms use to encode information,…
Q: On the gel diagram below, show how you believe these fragments will sort out during electrophoresis.…
A: DNA is a double stranded helical molecule that is made up of repeating nucleotides. The nucleotides…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps with 3 images
Can you please answer question 5.
According to your answers provide at question 2 there should be a certain number of bands visible on your gel. Suppo. you did this practical and you observed less bands on your gel, give possit I explanations for this.
- ull rain LTE 11:53 © 1 0 A 10% Done #1 Mol Bio Restriction Analysi... Complete the following problems. Restriction enzymes (REs), which cut D NA at specific sequences, are classic tools in molecular biology. Because of their specificity in cutting DNA, REs can be used to "map" DNA sequences by analyzing the fragments generated upon restriction digest, as in the example shown in Figure 1. Your task is to study the circular plasmid, pMBBS, through restriction digests. You subjected the PMBBS plasmid to complete digestion by different combinations of three REs (EcoRI, BamHI, and Xhol), and analyzed the results on an agarose gel, shown below. Using the data you can glean from this gel, answer the questions that follow. EcoRI BamHI Xhol DNA size ladder 600 bp 500 bp 400 bp 300 bp 200 bp 100 bp VC 100bp Plus DNA ladder from Vivantis Technologies *The same total amount of DNA was loaded in each lane. 1. What is the total size of the PMBBS plasmid in bp? Answer: bp 2. How many cut sites on the…EcoRI --- 5' G - AATTC 3' 5' AGAATTCCGACGTATTAGAATTCTTAT CCGCCGCCGGAATTCT CATCA 3' 3' TCTTAAGGCTGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5' Number of pieces of DNA , and type of fragment .11:29 Protein 6-10092015113530.pdf https:api.schoology.comv1attachment169963838... Name Class Date 2. How are enzymes involved in this process? 3. hаppens anzips"? 4. Why is it important that exact copies of DNA be made? 5. Suppose that a sequence of one DNA strand is T-A-C-A-A-C-G-T-G. What is the corresponding sequence on the other strand? E Concept Mapping The construction of and theory behind concept mapping are discussed on pages vil-ix in the front of this Study Guide. Read those pages carefully. Then consider the concepts presented in Section 7-1 and how you would organize them into a concept i page 74. Notice that the concept map has been started for you. Add the key Now look at the concept map for Chapter 7 on concepts you are important Secti When you have finished the chapter, you will have a completed concept map. 69 1 of 1
- 1_30*_SP23 - General Biology I (for majors)/1 of us page The anticodon sequence created from the following DNA: TACGGGGCTGAGATT F1 Select one: O a. Tyr-Gly-Ala-Glu-lle O b. AUGCCCCGACUCUAA c. UACGGGGCUGAGAUU O d. Met-Pro-Arg-Leu-STOP F2 # 80 F3 $ 000 000 F4 % F5 MacBook Air F6 & r F7 DII F8ersonal/eenongen_my_tnstate_edu/_layouts/15/doc.aspx?sourcedoc={a6b083c9-a226-4c31... ☆ Search (Option + Q) Review View Help Picture Editing A В ... During nucleic acid hybridization, the probe is labelled Question 1 options: for DNA stability to increase probe-test DNA binding to identify the location of probe and the test DNA binding for amplification Question 2 6. 9. 10 IV 13 14 Which of the following best describes the trait in the pedigree? Question 2 options: X-linked dominant X-linked recessive autosomal domiant autosomal recessive ON31_30*_SP23 - General Biology I (for m 24 ed out of nove flag evious page A $ Transcribe the following DNA: TACGGGGCTGAGATT Select one: O a. UACGGGGCUGAGAUU O b. Tyr-Gly-Ala-Glu-lle C. Met-Pro-Arg-Leu-STOP O d. AUGCCCCGACUCUAA MacBook Air
- ☆回 w Insert Format Tools Add-ons Help Last edit was yesterday at 8:08 AM TURN 100% Normal text Arial 11 BIUA E- 1E E E - E EX 2. 3 . 5. C Directions: Describe the process of DNA replication in the space below. Specifically reference the pictures in your answer. Your response will undergo a plagiarism check. Be sure to write your response in your own words. Be sure to reference and thoroughly explain: The relationship and importance of DNA replication and the cell cycle. The conservation of genetic information during replication. (Is it conservative? Semi-conservation? Dispersive? What does this mean?) The specific enzymes used in each step and indicate whether each of the enzymes is a synthesis reaction or a digestion reaction. Justify your answer through explanation. Identify the parameters and limitations of the enzymes working effectively. (What factors would limit or interfere with DNA replication?)During proofreading, which of the following enzymes reads the DNA? primase topoisomerase DNA pol helicaseI-Assume that a circular plasmid is 3200 base pairs in length and has restriction sites for HindIII restriction enzyme at the following locations: 400, 700, 1400, 2600. Give the expected sizes of the restriction fragments following complete digestion.
- #2 EcoRI --- 5’ G ↓AATTC 3’ 5’ ACG ACGTATTAGAATTCTTA TCCGCCGCCGGAATTCT CATCA 3’ 3’ TGC TGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:DNA GAAGGGACAATACTTTCTTAACACTTG MRNA Amino Acid Sequence 1. Which kind of protein molecule did this gene make? 2. How does this protein help the body maintain homeostasis? Conclusion Questions: 1. Examine the protein you created. If the DNA strand that you started with had a change in it (A changed to G), what would happen to the protein made?Kpnl 4. Plasmid Z has a size of 7 kb, and the map shows Kpnl (K) and Pstl (P) cut sites relative to each other. This plasmid was digested with three different restriction enzymes 2000 bp 3500 bp Kpnl (K), Pstl (P) and Bgll (B) either alone or in combination and the samples run on an agarose gel as shown below. Where does Bgll (B) cut this plasmid ? Does the plasmid have one recognition site or two for Bg|l? Describe the Bgll cut site in this plasmid relative to the Kpnl cut Plasmid Z -7 kb Pstl site. How many bases to the left or right of the Kpnl cut site would you observe the Bgll cut site. Explain briefly. 1500 bp Pstl Ladder Kpni Psti K/P Bgl K/B KPB 7000 bp 7000 bp 5600 bp 5500 bp 4900 bp 3500 bp 2000 bp 1500 bp 1500 bp 1500 bp 1400 bp 600 bp %3D