Kpnl4. Plasmid Z has a size of 7 kb, and the map shows Kpnl (K) andPstl (P) cut sites relative to each other.This plasmid was digested with three different restriction enzymes2000 bp3500 bpKpnl (K), Pstl (P) and Bgll (B) either alone or in combination and thesamples run on an agarose gel as shown below.Where does Bgll (B) cut this plasmid ? Does the plasmid have onerecognition site or two for Bg|l?Describe the Bgll cut site in this plasmid relative to the Kpnl cutPlasmid Z -7 kbPstlsite. How many bases to the left or right of the Kpnl cut site wouldyou observe the Bgll cut site. Explain briefly.1500 bpPstlLadderKpniPstiK/PBglK/BKPB7000 bp7000 bp5600 bp5500 bp4900 bp3500 bp2000 bp1500 bp1500 bp1500 bp1400 bp600 bp%3D

Bg2(B) contians restriction site in between Pst1 and Kpn1. Given plasmid have one restriction site…

Kpnl 4. Plasmid Z has a size of 7 kb, and the map shows Kpnl (K) and Pstl (P) cut sites relative to each other. This plasmid was digested with three different restriction enzymes 2000 bp 3500 bp Kpnl (K), Pstl (P) and Bgll (B) either alone or in combination and the samples run on an agarose gel as shown below. Where does Bgll (B) cut this plasmid ? Does the plasmid have one Plasmid Z -7 kb Pstl recognition site or two for Bgll? Describe the Bgll cut site in this plasmid relative to the Kpnl cut site. How many bases to the left or right of the Kpnl cut site would you observe the Bgll cut site. Explain briefly. 1500 bp Pstl Ladder Kpnl Psti K/P Bgl K/B KPB 7000 bp 7000 bp 5600 bp 5500 bp 4900 bp 3500 bp - 2000 bp 1500 bp 1500 bp 1500 bp 1400 bp 600 bp | || | ||

Kpnl 4. Plasmid Z has a size of 7 kb, and the map shows Kpnl (K) and Pstl (P) cut sites relative to each other. This plasmid was digested with three different restriction enzymes 2000 bp 3500 bp Kpnl (K), Pstl (P) and Bgll (B) either alone or in combination and the samples run on an agarose gel as shown below. Where does Bgll (B) cut this plasmid ? Does the plasmid have one Plasmid Z -7 kb Pstl recognition site or two for Bgll? Describe the Bgll cut site in this plasmid relative to the Kpnl cut site. How many bases to the left or right of the Kpnl cut site would you observe the Bgll cut site. Explain briefly. 1500 bp Pstl Ladder Kpnl Psti K/P Bgl K/B KPB 7000 bp 7000 bp 5600 bp 5500 bp 4900 bp 3500 bp - 2000 bp 1500 bp 1500 bp 1500 bp 1400 bp 600 bp | || | ||

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

You have another circular plasmid. Complete and effective digestion of this plasmid with a restriction enzyme yields three bands: 4kb, 2kb, and 1 kb. In comparing the band intensity on an ethidium bromide-stained gel, you notice that the 4 kb and the 2 kb bands have the exact same brightness. The 1 kb band is exactly one fourth as bright as each of these. (Assume there is uniform staining with ethidium bromide throughout the gel.) How many times did the enzyme cut the plasmid? What is the size of the plasmid? Justify your answers to a and b above using a clearly labeled diagram showing the relative location of the cut-sites on the plasmid.
Please answer this asap. Thanks, You have discovered a new plasmid RK21 in a unique bacterial community. As a first step towardunderstanding this plasmid, you digest the plasmid with three restriction enzymes: SspI, XhoI andSmaI. You run the digested plasmid DNA on an agarose gel, along with an uncut sample of theRK21 plasmid DNA as a control.Unfortunately you forget to load a DNA ladder, and obtain the following results. Assumecomplete digestion of all samples or all the digests worked completely
Kha Vu Danels Include: 8DX : Safehy Jor bromie tnto lab repart! Name Section date sheet MAPPING PRACTICE #1 Below is a restriction map for the plasmid PGEN 101 (total length = 20 Kb). Using this map as a guide, give the number of restriction fraqments along with their associated lengths that would result from digesting PGEN 101 with the restriction enzymes EcoRI, BamHI and a combination of ECORI and BamHI. BamHI 3.2 Kb 1.7 Kb EcoRI BamHI PGEN 101 8.7 Kb 5.5 Kb .9 Kb EcoRI ECORI DIGESTION PERFORMED SIZES OF FRAGMENTS OBTAINED 10.4 kb , 0.9kb, 8.7 Kb EcoRI 3.2 Kb, 16. 8kb BamHI EcoRI + BamHI
Section Name MAPPING PRACTICE #4 Plasmid pBR 607 is a 2.6 Kb plasmid containing Ampicillin and Tetracycline resistance markers, an origin of replication, and unique restriction sites for the restriction enzymes EcoRI, BamHI, and Pstl. Given the restriction map for pBR 607 for the enzymes EcoRI, BamHI, and Pstl, show on the gel diagram, where the approximate positions of the restriction fragments generated from the restriction digests would be located after carrying out electrophoresis. BamHI 0.2 Kb pBR 607 ECORI 1.94 Kb 0.46 Kb Pstl Size EcoRI EcoRI EcoRI + Standards BamHI + Pstl BamHI Pstl 4.0 Kb 2.2 Kb 2.0 Kb 0.5 Kb
You utilised two plasmids in this practical, pOTC and pOTC-Δ. Plasmids are often represented using plasmid maps like the one below. This map shows the positions of recognition sites for a number of restriction enzymes Using the plasmid map of pBCH2.0 provided above, predict how many DNA fragments would be formed if this plasmid was digested with restriction enzymes EcoRI and PvuII.
gene. If the JM109 strain is transformed by the PBKSK plasmid, the strain will produce the B-galactosidase (from the lac gene) and will hydrolyze X-gal to produce the blue compound. Therefore, colonies that were transformed and contain the pBSKS wil you appear blue. IPTG & X-Gal & NO colonies Amp E. coli JM109 E. coli JM109 50 mM calcium chloride-15% glycerol lac lac lac IPTG & I Recovery X-Gal solution at -702C PBSKS White colonies E. coli JM109 E. coli JM109 ampR amp I amp lac lac Heat Shock Non-transformed 42°C E. coli JM109 E. coli JM109 amps amps lac lac IPTG & X-Gal lac I Recovery lac PBSKS BLUE colonies PBSKS ampRI (amp Transformed IPTG & X-Gal & BLUE colonies Amp Hypotheses: Circle the correct answer 1. If PBSKS is transformed into JM109 cells, colonies will be (able/not able) to grow in the presence of ampicillin. a. Why? _ 2. If PBSKS is transformed into JM109 cells, colonies in media with IPTG (will/will not) induce the production the B- galactosidase enzyme. a. Why?_ 3. If…
Restriction digestion and Gel electrophoresis: A single strand of a double-stranded DNA sequence is shown below. Draw a complementary DNA strand and show the restriction digestion pattern of the double-stranded DNA with BamHI and Pst1. Show the separation pattern of the undigested and the digested DNA on your agarose gel. Label the gel appropriately. 5’ – CGAGCATTTGGATCCTGTGCAATCTGCAGTGCGAT – 3’
The transformation results below were obtained with 10 ul of intact plasmid DNA at nine concentrations. The following numbers of colonies are obtained when 100 ul of transformed cells are plated on selective medium: Fill in the following table: Concentration # colonies DNA mass of Fraction of Mass Transformation PGREEN (Concentration x volume OR X spread = x 10ul plasmid solution) PGREEN in cell Cell efficiency Y÷ A suspension suspension spread = 100 ul - total vol cell susp. (Colonies - Mass spread) C x Z = A See (510 ul) HINT: this calculation is constant Given= X Given=Y С. Z. 0.00001 ug/ul | 4 0.00005 ug/ul 12 0.0001 ug/ul 0.0005 ug/ul 32 125 0.001 ug/ul 442 0.005 µg/ul 0.01 ug/ul 0.05 ug/ul 0.1 ug/ul 542 507 475 516 0.5 ug/ul 505
Examine the structure of the pBR322 plasmid depicted below. Assume total size of the plasmid is 4,361 bp and the blue numbers indicate locations of restriction sites relative to the O point at the top of the plasmid. What size fragments would be generated by the following restriction digestion reactions? 1. Sall 2. Sal 1 + BamH1 3. Sal 1 + EcoR1 4. Sal I + BamH1 + EcoR1 PstI 3607 3000 4000 amp ori HindIII Edit View Insert Format Tools Table EcoRI EcoRV 4359 0 29 185 pBR322 4361 bp 2295 NdeI tet 2000 BamHI 375 651 SalI 1000 Type a short answer in the space provided below.
I-Assume that a circular plasmid is 3200 base pairs in length and has restriction sites for HindIII restriction enzyme at the following locations: 400, 700, 1400, 2600. Give the expected sizes of the restriction fragments following complete digestion.
A cloning vector map is shown below. EcoRI Bam Ban Hind P-galactosidase Amp Bam Bam EcoRI Ori C Which restriction site is best for inserting a DNA fragment for selection of chimeric plasmid containing colonies? 1) They're all equally good. 2) Hindll 3) EcoRI 4) BamHI
Primer designing: A single-stranded DNA sequence (963 nucleotides) that codes for a hypothetical protein are shown below (lower case shaded blue). 1. Design a pair of forward and reverse primers (~18 nucleotides long each) with EcoRI and BamHI added at 5' and 3' ends, respectively, for the amplification and cloning of this a plasmid with the same restriction sites. gene into GTATCGATAAGCTTGATATCGAATTCatggctaaaggcggagct cccgggttca aagtcgcaat acttggcgct gccggtggcattggccagccccttgcgatgttgatgaagatgaatcctctggtttctgttctacatctatatgatgtagtcaatgcccctggtgtcaccgctgatatta gccacatggacacgggtgctgtggtgcgtggattcttggggcagcagcagctggaggctgcgcttactggcatggatcttattatagtccctgcaggtgttcctcg aaaaccaggaatgacgagggatgatctgttcaaaataaacgcaggaattgtcaagactctgtgtgaagggattgcaaagtgttgtccaagagccattgtcaacctg atcagtaatcctgtgaactccaccgtgcccatcgcagctgaagttttcaagaaggctggaacttatgatccaaagcgacttctgggagttacaatgctcgacgtagt cagagccaatacctttgtggcagaagtattgggtcttgatcctcgggatgttgatgttccagttgttggcggtcatgetggtgtaaccatttgccccttctatctcagg…