(1) Describe the nitrogenous base pairing in DNA and RNA. (2) Determine the number of bonds in each nitrogenous base pairs.
Q: 29. Here is a strand of DNA: TACCCGGTATAACGCTGGAAAGCTTAAGCAACATCGCCCGACCCC AAATCT…
A: DNA strand given here with directionality is as: 5’…
Q: Gene X is expressed in the developing brain, heart, andlungs of mice. Mutations that selectively…
A: Mutations occur as a result of errors in DNA or viral replication, mitosis, meiosis, or other types…
Q: Enumerate the reagents used in extraction and isolation of RNA and their uses.
A: The purification of RNA from biological samples is known as RNA extraction. This method is…
Q: A protein has the opnino acid seruence that cates as follows: •N-terminas - Some More amino kids -…
A: Protein targeting or also called as protein localization is the process by which proteins get…
Q: ODD MAN OUT. Which of the following is not related to the other choices below? adenylyl cyclase…
A: Signaling is the process of communication between the cells, and between the cells and the…
Q: Aspartic acid has a side chain bearing a carboxylic acid group; its pKą is ~4. The alpha-carboxylic…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: Describe the ion dynamics of the muscle-contraction process.
A: Tension-generating regions within muscle cells are activated during muscular contraction. Muscular…
Q: The pH vs charge graph for a triprotic amino acid is shown below. Please answer the following…
A: An amino acid with the ability to donate 3 protons (3 H+) is called a triprotic amino acid. The 3…
Q: From the diagram to the right of the trp repressor in its (i) approximate binding relationship to a…
A: Given Figure shown trp repressor protein bond to DNA double strand. Protein is mainly comprised of…
Q: When do plants usually undergo mitochondrial respiration?
A: Mitochondrial respiration is commonly known as cellular respiration. This is the process of energy…
Q: TRUE OR FALSE: 1. The 35S precursor is the precursor RNA transcript for all ribosomal RNAs except…
A: Ribosomal RNA is the component of Ribosomes which is essential for translation and forcing tRNA and…
Q: 2. Calculate the overall charge (pH 7) on the following three polypeptides and answer the questions…
A: Hi! Thank you for the question. We are authorized to answer three subparts at a time, since you have…
Q: Suppose you want to determine if excessive lipid ingestion altersgene transcription. Describe and…
A: Dietary fat is a crucial macronutrient for the increase and development of all organisms. In…
Q: *Which of the following statements about allosteric enzymes is NOT true? Question 10 options: - They…
A: Enzymes are biocatalysts that increase the rate of a reaction by a factor of several. Living cells…
Q: Now let us look at a real amino acid, alanine. Fill in the chart below for each ionizable group. You…
A: Amino acids are the building block of proteins. Amino acids are consisted of carboxyl group, amine…
Q: What part of the electron transport chain is responsible for the greatest contribution to oxidative…
A: Protein complexes are present in the inner membrane of mitochondria forming an electron transport…
Q: QUESTION; — Compare and contrast the degradation pathways of purines and pyrimidines, making sure to…
A: Nucleotides are used in nucleic acid synthesis, intermediate metabolic processes, and the breakdown…
Q: 2. The kinetic effect of purely competitive inhibitor of an enzyme: (A) Increases K, without…
A: Hi. Thank you for the question. As per the honor code, we are allowed to answer three sub-parts at a…
Q: In plants, under what solution conditions are Calvin cycle and gluconeogenesis enzymes most active?…
A: Gluconeogenesis is the process of Synthesis of glucose from non Carbohydrate sources like aminoacids…
Q: Question 24 CH,-0-C-(CH,)14–CH, CH-0-C-(CH,)16-CH, CH3 сH, —о—р—о—сH, — сн, — N—сH, CH, What is the…
A: Depending on the strut of lipid ,they are classified as simple and complex lipid. Simple lipids are…
Q: Which of the following is the primary method by which cyclin proteins are regulated to influence…
A: A. Transcriptional upregulation and translation followed by targeted ubiquitin-mediated degradation…
Q: 8. In the Stomach: a. Is there digestion? YES or NO b. If YES, then answer i-iv to explain. If NO,…
A: Fats are esters of fatty acids , also called as lipids/triglycerides.
Q: What carbohydrate is generally detected using the Molisch test? *
A: Carbohydrates are polyhydroxy aldehydes or ketones commonly called as sugars or saccharides.…
Q: Draw the Fischer projection formula for each sugar and give the importance/use of each. D-…
A: The monosaccharides are required to form oligo and polysacharides. Monosaccharides may be aldoses or…
Q: A. Name the two proteins that induce a negative feedback in this pathway and explain why both…
A: Since, you have posted multiple questions we will solve the first question for you. If you want any…
Q: Nascent form of the mRNA A. undergoes splicing only after capping B. is also called hnRNA C. is…
A: A. undergoes splicing only after capping B. is also called hnRNA D. participates in the spliceosome…
Q: Explain to me what factors influence permeability versus solubility?
A: To understand the factors effecting the solubility and permeability it is essential to understand…
Q: Arrange signalling cascade events in chronological order.…
A: Signaling pathways helps to respond the cells according to the external stimuli. The external…
Q: lycogen isolated from liver biopsy specimen had normal structure. Blood glucose level was below…
A: Introduction: Glycogen storage disease is a group of disorders that is characterized deposition of…
Q: The questions ask you to identify which compounds have a specific functional group. For each…
A: Here all the compounds given are organic compounds with Carbon and hydrogen back bone structure. It…
Q: COMPLETE THE TABLE OF 10 STEP OF GLYCOLYSIS BY REFERRING TO THE GLYCOLYSIS PATHWAY
A: The chemica; interconversion steps, that is the sequence of reaction by which glucose is converted…
Q: 5. Convert each of the following 3' to 5' DNA sequences to 5' to 3' DNA sequences. a. 3' ATCG 5' b.…
A: DNA contains all the genetic information of an organism in the form of genes. These genes are…
Q: 13. Which of the following is an example for derived lipids? A. steroids B. terpenes C. carotenoids…
A: Hi! Since you have posted multiple question, we shall answer the first question for as we are only…
Q: Match lipid structures in column A with its lipid type in column B esters of fatty acids with long…
A: The question include match the following with different options. The correct options are mentioned…
Q: malate + NAD+ oxaloacetate + NADH + H+ If the pH = 7 and [malate] = 0.0010 M, [oxaloacetate] =…
A: Malate + NAD+ →Malate dehydrogenase Oxaloacetate + NADH + H+ Above reaction is the last step of…
Q: Study the given structures below. Which of the following are enantiomers? * H- OH но- - H OH но- -H…
A: Carbohydrates or carbs are maconutrient consisting of Carbon, hydrogen and oxygen atoms. In nature…
Q: HIN A openvellum.ecollege.com 01+| 1叩 Assignments Review I Constants I Periodic Table Part B nts.…
A: Steroids are a prominent class of lipids with structures that are completely distinct from those of…
Q: Restriction digestion and Gel electrophoresis: A single strand of a double-stranded DNA sequence is…
A: Restriction digestion is a process in which DNA is cut into smaller pieces at specific sites with…
Q: LIPIDS Functions Chemical Components 1. 1. 2. Two Primary Categories of Lipids 2. 3. 3 4. Two…
A: Functions of lipids: 1. Storage of energy 2. Transmit nerve impulses 3. Structure of cell membranes…
Q: reaction as a function of substrate concentration. Ex- plain why the maximal velocity can be…
A: Enzyme kinetics is the study of the rate of enzyme catalyzed bio chemical reactions and also we can…
Q: Given a part of DNA undergoing replication. Copy and write the corresponding bases in the new…
A: Semiconservative mode of DNA replication describes the mechanism of DNA replication in all living…
Q: TRUE OR FALSE 1. In the structure of Aztreonam, addition of a moiety capable of Van de Waals…
A: Aztreonam is an antibiotic like penicillin and it inhibits the peptidoglycan crosslinking enzyme…
Q: The glycerol-3-phosphate shuttle can transport cytosolic NADH equivalents into the mitochondrial…
A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…
Q: Which of the below statements is correct regarding tertiary structure? All are correct Disulfide…
A: A protein has four structural levels of organization – primary, secondary, tertiary and quaternary…
Q: Which of the following WILL PROMOTE sol formation of neutral polysaccharide sample? a. place the…
A: Polysaccharides are used for hydrogel formation nowadays which is diversely used in the field of…
Q: Which of the following is NOT a primary method used to regulate the activity of cyclin-dependent…
A: Cyclin-dependent kinases (CDKs) are the protein kinases which plays a role in regulating the cell…
Q: Many malignant tumors are characterized by the activation of one or more growth-factor receptors.…
A: Malignant tumours (or "cancers") are classified as monoclonal, which means that each tumour develops…
Q: Rory’s father was working on the electrical wiring his basement. Rory noticed that his father wore…
A: Rory's father was wearing rubber gloves, which are known to be one of the defense mechanisms while…
Q: Which of the polysaccharides WILL DECREASE GELLING if acid is added to the sample? pectins…
A: Gels are solid, jelly-like structures made of colloid polysaccharides, proteins, and polymers…
Q: lysozyme was purified through G50 beads. From your lab experience, you can determine that when going…
A: Chromatography is biochemical separation method for organic molecules or solutes of a compound…
(1) Describe the nitrogenous base pairing in DNA and RNA.
(2) Determine the number of bonds in each nitrogenous base pairs.
Step by step
Solved in 2 steps with 2 images
- RNA differs from DNA in that: a) The ribose in RNA nucleotides contains fewer oxygen atoms than does deoxyribose DNA nucleotides. b) It is always single stranded and cannot form base pairs. c) It contains the nucleotide uracil, which pairs with thymine. d) It is single-stranded but can fold into a variety of structures, some of which are double-stranded. e) RNA can only be found in the cytoplasm whereas DNA can only be found in the nucleus.Name the three nitrogen bases of DNA and RNA.Name the nitrogen bases of DNA and RNA.
- A) What is the difference between a nucleoside and a nucleotide? B) Give any two differences between DNA and RNA. C) Draw the structure of deoxyribose and ribose below, and number the carbons. What is the difference between the two structures? Please answer all 3 parts1. a) What does DNA stand for? b)What is the name of the DNA structure?The DNA of different species differs in the (a) sequence of bases. (b) complementary base-pairing. (c) number of nucleotide strands. (d) location of the sugar-phosphate portion of the DNA molecule.
- How does DNA differ from RNA with respect to the following characteristics? a) number of chains b) bases used c) sugar used. Which of the following statements best summarizes the differences between DNA and RNA? A) DNA is transcribed using RNA polymerase to form mRNA and mRNA is translated by the Ribosome to form a polypeptide, B) The bases in DNA contain sugars, whereas the bases in RNA do not contain sugar. C) DNA nucleotides contain a different glucose compared to RNA nucleotides. D) DNA is formed using the base uracil, whereas RNA uses the base thymine. E) DNA encodes the sequence of amino acids for the primary structure of a polypeptide whereas mRNA does not1. Label each statement about the polynucleotide ATGGCG as true or false. a) The polynucleotide contains six phosphodiester linkages. b) The nucleotide at the 5 ' end contains the base guanine. c) The nucleotide at the 3 ' end contains the base guanine. d) The polynucleotide could be part of a DNA molecule. e) The polynucleotide could be part of an RNA molecule.