List the complementary non-coding DNA sequence. CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCCC . . .
Q: "supercoiling" mean in the context of DNA structure? Define or explain the difference between…
A: DNA is made up of various nucleotides that store genetic information in it. DNA is packed into a…
Q: What is the mRNA coded by this template DNA strand? DNA Template Strand: 3' ATGGTACGGTCG 5'…
A: A codon is known to code by three different types of bases in a particular mRNA. Hence, a codon is…
Q: Explain the sequence of the four letters of the DNA alphabet?
A: Deoxyribonucleic acid (DNA) consists of genetic instructions in the form of gene sequences. These…
Q: 1. How do you determine the purity of DNA? If a DNA has 1.8 A260/A280 ratio, what does it mean? What…
A: DNA is a molecule made up of two polynucleotide chains that form a double helix and carry genetic…
Q: Give the corresponding strand of the DNA having the sequence of: a. 5’…
A: DNA(deoxyribonucleic acid) is the heredity material for most living organisms. It is composed of…
Q: ing the gel picture of the DNA ladder, show where your digestion of the paper cutting model showing…
A: DNA is a double stranded biomolecule. The DNA is usually digested by endonucleases and exonucleases…
Q: What is the nature of genetic mutation of DNA repair proteins?
A: DNA repair proteins are those that are involved in repair of damaged or mutated DNA. Mutations can…
Q: 5. The nucleotide sequences of the DNA molecules in the figure below were obtained from four…
A: Deoxy ribonucleic acid (DNA) is the genetic material that contains coded genetic sequence in the…
Q: 13. What is the complimentary sequence of the following strand? CCCCTTAGGAACC? a. CCCCTTAGGAACC b.…
A: Nucleic acids are biopolymers formed of repeating units of monomers called nucleotides. There are…
Q: 1) What DNA base sequence is complementary to the following DNA sequence? TAGCGTGCATGGTGCTTAAC 2)…
A: Introduction: DNA stands for 'deoxyribonucleic acid' and it is the hereditary material in humans and…
Q: .1. Give the complete complimentary bases of the parent DNA strand according to Chargaff's rule and…
A: The Chargaff’s rule state that the quality of the nitrogenous base pairs in the DNA is always equal.…
Q: How do I translate the DNA sequence below: 5'-ATGGCCTGGCATTCA-3' 3'-TACCGGACCGTAAGT-5'
A: DNA stands for Deoxyribonucleic acid. It is a molecule composed of two polynucleotide chains to form…
Q: Explain DNA polymerase?
A: Deoxyribonucleic acid (DNA) is a double-stranded molecule, which consists of two strands of…
Q: 1. (a) What will be the newly synthesized DNA from the template given? DNA Template 3 -…
A: The base-pairing rule in DNA is that cytosine (C) pairs with guanine(G) and adenine (A) pairs with…
Q: Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT
A:
Q: 10. In the diagram below, Transcribe the two new complementary strands of DNA. ,ΑTIGCCAAGT…
A: According to the question, we have seen a diagram, where we have to transcribe the two new…
Q: 1. How may recombinant DNA molecules be introduced into human cells? a. by splicing the needed…
A: As per the guidelines, we are supposed to answer only one question. Kindly repost the other question…
Q: The functions ascribed to the genetic material are replication, expression, storage, and mutation.…
A: Genetics is a branch of the biology involved in the study of genes, genetic variation, and heredity…
Q: Plssssss helppppp Are mutations in DNA advantageous or disadvantageous?
A: DNA is made by a sequence of nucleotides arranged in a certain order. Any change in this sequence is…
Q: A small section of bacterial DNA template (antisense) strand has the following nucleotide sequence:…
A: When a single base nucleotide is changed, it is called as point mutation. Non sense mutation, is a…
Q: 6. Write a brief paragraph each to explain what an insertion sequence and a transposon are. 7. What…
A: 1. Inclusion arrangements (Insertion sequences) (ISs) are little bits of DNA which move inside or…
Q: What are the frequency and percentage distribution of amino acids in the polypeptides coded by the…
A: Introduction When a DNA gene is disrupted or damaged in such a way that the genetic message carried…
Q: 7. Explain the principle of quality determination of DNA.
A: *NOTE: Kindly repost for other questions. Dear Student as per the guidelines we are supposed to…
Q: Write out the resulting DNA molecules after the following double stranded DNA molecule is digested…
A: DNA stands for deoxyribonucleic and. It is the genetic material present in the cell.
Q: If you will use apple or strawberries instead of banana do you think the result would be the same in…
A: All living things pass hereditary information from one generation to another using DNA as the basic…
Q: E14. A sample of DNA was subjected to automated DNA sequencing and the output is shown here. WWww…
A: DNA Sequencing is the technique to determine the order of the nucleotides within the DNA…
Q: 1. This image summarizes how computers sort and order DNA fragments to produce a final sequence of…
A: Nucleic acid is chemically different than protein and carbohydrate . This difference helps in…
Q: D) Draw the first two (2) base pairings of the DNA molecule from the 5' end and label all key…
A: The self replicating biomolecules that are present in the chromosomes and carry genetic information…
Q: 1. Which pieces of DNA are the most informative? Why?
A: as per our company guidelines we are supposed to answer only first 1question. Kindly repost other…
Q: 1. Write the complementary base sequence for the matching strand in the following DNA section:…
A: Introduction: Complementarity is the fundamental concept of DNA replication and transcription since…
Q: 19.Examine the following DNA sequence and determine what type of mutation, if any, produced the…
A: Mutations are certain modifications takes place in the sequence in DNA . Mutations is classified as…
Q: How many codons are there in the mutated DNA - (b) and DNA - (c)?
A: DNA is the store house of genetic information. This genetic information expressed by the formation…
Q: State what percentage of the human genome is noncoding, and describe the four noncoding types of…
A: The components of the DNA of an organism that does not code for any protein sequences are known as…
Q: 1. Explain why DNA fragments can be separated using an electric current. How does the size of the…
A: 1.DNA fragments can be separated by the application of current this process of separating DNA occurs…
Q: Why is the TP53 called the guardian of the genome?
A: Genome The genome of an organism consist of whole genetic material. The both part of gene coding…
Q: 1. Written below is a DNA seqeunce: G G C A A C T A T C C C G A T T A G C G C Write down the…
A: Deoxyribonucleic acid (DNA) is a biomolecule found in nearly all living organisms. The structure of…
Q: 3’atgtaccatgcgcaaatttaaaggccc5’. a) Using this single template strand of a DNA as a template, write…
A: Deoxyribonucleic acid (DNA) is a biomolecule found in nearly all living organisms. The structure of…
Q: Discuss the characteristic of DNA polymerase 1, Nick translation Proofreading
A: The heterocatalytic process by which a new DNA stand is synthesized on a old DNA template is known…
Q: List the DNA strand sequence complementary to the template strand.…
A: DNA contains Adenine thymine, cytosine, and Guanine. Whereas in RNA the Thymine is replaced by…
Q: Numbering the fragments left by cutting the DNA with BAM HI from left to right, which fragment will…
A: BamHI is a type II restriction endonuclease that can recognize short DNA sequences (6 bp) and cleave…
Q: WHY DO WE NEED GENETIC ENGINEERING?
A: Genetic engineering is a vast field that mainly involves using rDNA technology to genetically alter…
Q: 6. What are the sides of the DNA ladder made of? a. b.
A: DNA or deoxyribonucleic acid is the molecule that contains genetic code of organisms. It forms a…
Q: Why is that DNA polymerase and RNA polymerase can synthesize polynucleotides only from 5' to 3' to…
A: DNA polymerase is the enzyme required for replication of DNA and RNA polymerase is the enzyme…
Q: What is the DNA complement to this DNA sequence: TGAGCCTTAGGA? O UCTCGGUUTCCT O ACTCGGAATCCT O…
A: The DNA (deoxyribonucleic acid) is genetic material of an organism that it inherits from the parent…
Q: 5'-AAGCGGGTGTGAGGAGCGCGGCAGCTCAGGTACCCCCGGCCAGGCGCG-3' 31-TTCGCCCACACTCCTCGCGCCGT…
A:
Q: 1. what will be the mRNA complimentary strand of a DNA sequence AATCGGCTGGGATTA? a. UUAGCCGACCCUAAU…
A: DNA replication is a proces by which molecule of DNA is duplicated. DNA replication is necessary to…
Q: Describe the three important functions of DnaA protein.
A: The protein that helps in the activation of DNA replication initiation in bacteria is DnaA. It…
Q: If part of a gene had the base sequence TGC CAT, what would be the base sequence of the…
A: DNA (Deoxyribonucleic acid) is one of the nucleic acid elements which contains the genetic…
Q: .If the template DNA sequence is 3' - CCC - ATA - GAG - AAA - 5' , then what is the corresponding…
A: DNA replication is a process in which new copies of DNA is made.The mode of DNA replication is…
1. List the complementary non-coding DNA sequence.
CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCCC . . .
Step by step
Solved in 3 steps with 2 images
- 30 A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT… …TGCCGTTCTAGGGTGGGATTAGTCTGGCATGGTAAGTGGAGGA… a)Locate the sequence encoding the five amino acids of the polypeptide, and identify the template and coding strand.What is the consensus sequence of the following six DNA sequences?GGCATTGACTGCCATTGTCACGCATAGTCAGGAAATGGGAGGCTTTGTCAGGCATAGTCABelow is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ 1.Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would this have on the protein? Look up an example for this type of mutation. 2, Assume the 5th and 6th amino acids are removed from the DNA template strand. What type of mutation is this? How would this affect the protein? Look up an example of this type of mutation. 3.Which mutation changes the protein more...a point mutation or a frameshift mutation. Explain your reasoning. 4.What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 5. What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this?…
- 1. (a) What will be the newly synthesized DNA from the template given? DNA Template 3 - CGGATGCCCGTATAC -5 3 - GCCTACGGGCATATG -5 5 - GCCTACGGGCATAAG -3 5 - GCCTACGGGCATATG -3 3 - CGGATGCCCGTATAC -5 (b) Which is the DNA template given if the mRNA is 5 - CGGAUGCCCGUAUACGUA -3 ? 3 - GCCTACGGGCATATGGTA -5 5 - GCCTACGGGCATAAGGAT -3 5 - GCCTACGGGCATATGCAT -3 3 - CGGATGCCCGTATACCTA -52) Create an MRNA strand based on the given DNA template strand: TACTTCCTATTITCTTGTCA CCGCACT 3) Using the mRNA codon chart, determine the amino acid sequence for the MRNA sequence determined in question 3. 4) Consider the following double-stranded DNA molecule: Complementary Strand: ATGTGTAGTGCGAGTTGA Template Strand: TACACATCACGCTCAACT a) What would be the amino acid sequence coded for by the template strand of the DNA molecule above?1. The nontemplate strand of a segment of double- helical DNA contains the sequence: (5')CGCTATAGCGTTTAG (3') (a) What is the MRNA base sequence that can be transcribed from this double helical DNA assuming you already have a ready RNA polymerase present and everything else needed for RNA transcription? Label the sequence ends and list what is required for RNA Pol to work. (b) What amino acid sequence could be coded by the MRNA in (a)'s answer assuming the AUG start codon is just upstream of the MRNA (not shown in the sequence provided)? Use table in Figure 27-7 of the Lehninger 7 th ed "Dictionary of amino acid code words in mRNAs" and write the peptide according to standard convention with abbreviations for the amino acids. (c) If the wrong strand was transcribed and then translated from the section of double stranded DNA shown above, what would the resulting amino acid sequence be? What would the mRNA sequence be? Explain your answer and label all strands. A. First letter of codon…
- 1. The nontemplate strand of a segment of double- helical DNA contains the sequence: (5')CGCTATAGCGTTTAG (3') (a) What is the MRNA base sequence that can be transcribed from this double helical DNA assuming you already have a ready RNA polymerase present and everything else needed for RNA transcription? Label the sequence ends and list what is required for RNA Pol to work. (b) What amino acid sequence could be coded by the mRNA in (a)'s answer assuming the AUG start codon is just upstream of the MRNA (not shown in the sequence provided)? Use table in Figure 27-7 of the Lehninger 7 th ed "Dictionary of amino acid code words in mRNAs" and write the peptide according to standard convention with abbreviations for the amino acids. (c) If the wrong strand was transcribed and then translated from the section of double stranded DNA shown above, what would the resulting amino acid sequence be? What would the MRNA sequence be? Explain your answer and label all strands. 歐歐队 相阳阳一即即的 9 First letter…1. (a) What will be the mRNA produced from the given template? DNA Template 3 - ATTGCGGATGCCCGTATACG -5 DNA Template 3 - ATTGCGGATGCCCGTATACG -5 3 - AUUGCGGAUGCCCGUAUACG -5 5 - AUUGCGGAUGCCCGUAUACG -3 5 - AUUGCGGAUGCCCGUAUACG -3 3 - UAACGCCUACGGGCAUAUGC -5 (b) What will be the anticodons that will arrive in the translation of mRNA below? mRNA 5 - AAUAUGCGGAUGCCCGAA -3 "AAU, AUG, CGG, AUG, CCC, GAA" "UAC, GCC, UAC, GGG, CAA" "AUG, CGG, AUG, CCC, GAA" "UUA, UAC, GCC, UAC, GGG, CAA"30 A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT… …TGCCGTTCTAGGGTGGGATTAGTCTGGCATGGTAAGTGGAGGA… b)Give the sequence and polarity of the mRNA encoding the polypeptide.
- Consider the following segment of DNA, which is part of a linear chromosome: LEFT 5’.…TGACTGACAGTC….3’ 3’.…ACTGACTGTCAG….5’ RIGHT During RNA transcription, this double-strand DNA molecule is separated into two single strands from the right to the left and the RNA polymerase is also moving from the right to the left of the segment. _____________ is the template strand for the synthesis of RNA? The sequence of the newly transcribed mRNA is _________________. Question 5 options: The top strand, 5'...GACUGUCAGUCA...3' The bottom strand, 5'...ACUCACUCUCAG...3' The top strand, 5'...UGACUGACAGUC...3' The bottom strand, 5'...GACUGUCAGUCA...3'This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' (i) Draw the structure of hairpin loop that will be formed during the end of transcription. (ii) Describe the function of the hairpin loop during transcription.I have a question I'm not sure about here it is...... If a short sequence of DNA is 5’-CGTAATCGGATC-3’, its complementary RNA strand is The answers given are: 5’- GCAUUAGCCUAG -3’. 5’- GAUCCGAUUACG - 3’. 5’-GATCCGATTACG - 3’. 5’-GCATTAGCCTAG - 3’.