ing the gel picture of the DNA ladder, show where your digestion of the paper cutting model showing cut fragments would appear. The linear uncut DNA is 640 base pairs in length. Insert an image below

Q: Next generation sequencing using Illumina platforms identifies individual bases in a DNA fragment…

A: The following steps are involved in next generation sequencing: 1) First the DNA sequencing…

Q: A circular DNA of 40 kb (40,000 bases) length is cut with a restriction enzyme whose precise…

A: The probability of a restriction enzyme to be found in a DNA is 4n, where n is the number of bases…

Q: 5) PCR primers have a melting temperature (Tm) at which they become dissociated from the template…

A: A primer is a short strand of nucleotide molecules that serves as an initial point for the synthesis…

Q: A piece of DNA fragment is sequenced. You clone the the fragment, isolate the cloned DNA fragment,…

A: While deciphering a sequencing gel, we know that it depends on terminating the reaction at 3' end…

Q: 2. Shown below is a long template strand of DNA where lagging strand DNA synthesis is occurring. The…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: 5. Describe the process of DNA sequence of interest detection, using these terms appropriately,…

A: Introduction:  DNA sequencing method is used to determine the exact base sequence in a DNA.  Three…

Q: 1. Restriction enzymes are extensively used in molecular biology. Below are the recognition sites of…

A: Overhangs are single stranded ends of the DNA nucleotides which are formed by when the DNA is…

Q: Which of the following actions in the DNA extraction of strawberry separates the DNA from the rest…

A: You have asked mutiple questions.  I will answer the 1st question,  as allowed by guidelines.  Asked…

Q: 1) You would like to clone a gene by PCR. The sequence of the two ends of the coding strand for the…

A: A laboratory technique for amplifying DNA sequences is polymerase chain reaction (PCR). The approach…

Q: 1. (a) What will be the newly synthesized DNA from the template given? DNA Template 3 -…

A: The base-pairing rule in DNA is that cytosine (C) pairs with guanine(G) and adenine (A) pairs with…

Q: What will be the mRNA produced from the given template? DNA Template 3 - ATTGCGGATGCCCGTATACG -5 DNA…

A: There are two types of nucleic acids, DNA and RNA. Nucleotides are the building blocks of nucleic…

Q: 18. An instructor had her students perform this laboratory beginning with setting up their own…

A: Agarose gel electrophoresis is the technique for the separation of DNA fragments on the basis of…

Q: 1. Calculate the size of the resulting fragments as they will occur after digestion and write the…

A: Hello. Since your question has multiple parts, we will solve the first question for you. If you want…

Q: What to restriction enzymes do? O They cut at specific locations on both strands in the…

A:

Q: 4. The image below is based on the Meselson Stahl experiment where bacteria are grown in 15N and…

A: The Meselson-Stahl experiment showed that DNA replication is a semiconservative process. In this…

Q: 7. You are tasked with amplifying a fragment of interest from a sample of genomic DNA by using PCR.…

A: PCR stands for the polymerase chain reaction. It is described as a test that is used to detect the…

Q: Which of the following matches is not correct? a. Template = Double stranded DNA b. Primer = short…

A: Introduction DNA is the molecular structure that is composed of a pair of polynucleotide chains and…

Q: Answer the following Mutated DNA Template Strand #1: 3’-T A C T G T C T G A C G A T C-5’…

A: The central dogma depicts the flow of genetic information into cells, the replication of genomic…

Q: If you will use apple or strawberries instead of banana do you think the result would be the same in…

A: All living things pass hereditary information from one generation to another using DNA as the basic…

Q: TRUE OR FALSE: a) Okazaki fragments are short DNA pieces that explain how the DNA polymerase can…

A: DNA replication process is semi conservative. The semi conservative replication of DNA refers to the…

Q: 5. Below is an image of DNA sequenced using the Sanger sequencing method, where different…

A: Gel electrophoresis is a molecular technique that aims to separate the DNA, RNA, and protein…

Q: 3. Give a schematic diagram of the different steps involved in PCR (Polymerised chain reaction) of a…

A:

Q: You have a DNA sequence of 1400 bp. To characterize it, you decide to make a restriction map.…

A: DNA is a nucleotide polymer present in living beings.

Q: You have two PCR primers: Forward- 5' TGAGCTAGGC 3' and Reverse- 5' GGTTCAGTCAG 3'. Show the binding…

A:

Q: 1. Given the following restriction endonucleases and the sequences of their corresponding…

A: Prokaryotic cells are unicellular organisms that differ from multicellular organisms in composition…

Q: 2. The restriction enzymes Xhol and Sall cut their specific sequences as shown below: Xhol 5'-c…

A: Restriction enzyme are also referred as restriction endonuclease. They are considered as a protein…

Q: Because DNA can only be synthesized in the 5' to 3' direction...   A. The template DNA must be…

A: DNA stands for deoxyribonucleic acid. It is the genetic material of the organisms that transfer from…

Q: Sanger DNA sequencing/ dideoxy sequencing was used as shown in the diagram below. The arrow…

A: Sanger's sequencing method. It is a method based on DNA synthesis. In normal DNA synthesis,…

Q: 3. A long DNA will be divided into small fragments, and one of them will be attached to the bead and…

A: Ion torrent sequencing is the method of sequencing by signals of pH change voltage generation, which…

Q: Which is the odd one out ? For the rest, explain the concept/process/technique they are involved…

A: DNA Polymerase is the main enzyme of replication. It adds deoxyribonucleotides according to the…

Q: Your colleague made the table below comparing DNA Polymerase to RNA Polymerases. Which row is…

A: Transcription is the molecular process which involves the DNA sequences that are transcribed as…

Q: _1. Bacterial proteins that have the ability to cut both strands of the DNA molecule at certain…

A: DNA and RNA are the two main forms of nucleic acids. Nucleotides, which have a five-carbon sugar…

Q: 1. The polymerase chain reaction (PCR) is used by scientists to amplify DNA, particularly when the…

A: We are answering 1st question only. For the rest of the questions please repost. The polymerase…

Q: 1) Develop an analogy for the processes researchers use to make changes to DNA. In analogy, explain…

A: Nucleic acids are macromolecules composed of nucleotides (sugar, phosphate, and nitrogen base) bound…

Q: The Southern blot procedure was developed so that: DNA fragments that have been subjected to…

A: Southern blotting is the technique for the detection of specific DNA fragments. The detailed…

Q: The diagram shows an autoradiograph of a DNA sequencing gel. What is the 5' to 3' sequence of the…

A: Gel electrophoresis is a technique which is used to separate the molecules based on the size of the…

Q: These sequences are obtained as part of a human genome sequencing project using a library of 150 kb…

A: Contigs are the overlapping sequences present on DNA fragments. Each set of contigs is counted as…

Q: 4. A linear fragment of DNA is exposed to a digest containing the individual restriction enzymes…

A: For doing restriction mapping we need to arrange each fragments at it's proper position. The process…

Q: 9. Five DNA samples are shown along with their recognition sites where a particular restriction…

A: Gel electrophoresis Gel electrophoresis is a molecular technique that involves the separation of DNA…

Q: What is the name of the process by which bacteria pick up a different organism’s genetic material?

A: 4. A bacterium takes up a fragment of DNA circulating in its surroundings during transformation. A…

Q: 2.Fill in the blank with the best answer. If band 3 (6 kB) in lane 5 contains 280 ng of DNA, then…

A: Fill in the blank the question.  Average weight of one DNA base pairs= 650 Dalton.  1 Dalton =…

Q: 3. Look at the sequences below. If you add a restriction enzyme(that cuts at GAATTC) to the uncut…

A: as per our company guidelines we are supposed to answer only first 3 sub-parts. Kindly repost other…

Q: 5. A scientist was studying a fragment of eukaryotic DNA that she suspected was involved in a…

A: A restriction endonuclease or restriction enzyme is a bacterial enzyme that cuts dsDNA into…

Q: How is a randomized DNA library created?   MARK ALL THAT APPLY. the use of Mn2+ rather than Mg2+ by…

A: DNA libraries are a collection of a large number of various genes of choice kept or stored together…

Q: 1. A linear DNA molecule is subjected to complete restriction digestion by (1) EcoR1 alone, (2)…

A: Restriction enzyme or restriction endonuclease are bacterial protein that cleaves DNA at specific…

Q: 3. The data in the following table represent the base composition of two double stranded DNA sources…

A: Ervin Chargaff discovered the Base proportion in double stranded DNA. The findings in his study came…

Q: Once you had your DNA sample extracted from your cells, why did we add the yellow Master Mix…

A: The DNA sample extracted from the cells is amplified using a method called the Polymerase Chain…

Q: 1. Which of the following are generated due to the twisting of dsDNA?  a. Hydrophobic bonds b. Van…

A: DNA acts as genetic material in most organisms. DNA is a double-helical structure in which two…

Q: Restriction enzymes in bacterial cytoplasm cut injected bacteriophage DNA wherever certain sequences…

A: Enzymes are the protein which acts as catalyst in the chemical reactions. Enzymes neither takes part…

Q: The restriction endonuclease BamHI recognizes the sequence GGATCC and cleaves between the Gs (in…

A: BamHI recognition sequence: GGATCC cleavage occurs between the two Gs Bgl II recognition sequence:…