A piece of DNA fragment is sequenced. You clone the the fragment, isolate the cloned DNA fragment, and set up a series of four dideoxy reaction. You then separate the products of the reaction by gel electrophoresis and obtain the following banding patter: ddATP ddTTP ddCTP ddGTP What is the base sequence of the original fragment that you were given? 0 5-ТАAGCTGA-3' 0 5-АТTCGACТ-3' 5'-TCAGCTTA-3' 5'-AGTCGAAT-3'
Q: For the following short sequence of double stranded DNA, design primers (just ~ 3-4 bases) and show…
A: Polymerase (PCR) chain reaction is a process in which small DNA fragments are amplified into a…
Q: A piece of human DNA is treated with two common restriction enzymes. The DNA piece in question is 50…
A: Restriction enzymes are a specific group of enzymes that can recognize a specific short sequence of…
Q: Which 2 primers will copy the entire sequence of DNA: 5'…
A: Primer is a short nucleotide sequence which is required to initiate DNA replication . To the primers…
Q: Transcribe and Translate the DNA strand: ORIGINAL DNA TAC/ACC/TTG/GCG/ACG/ Strand: RNA strand: Amino…
A: Transcription is the process in which m RNA is synthesized and the translation is the process in…
Q: For the chromatogram below, what is the sequence of the template DNA from base 115 to 125?…
A: According to the question, we have to answer the question that which is for the chromatograph below,…
Q: A linear piece of DNA that is 30 kb long is first cut with BamHI, then with HpaII, and, finally,…
A: The restriction enzyme is a protein and it recognizes a specific sequence of short nucleotides and…
Q: A linear piece of DNA was broken into random, overlapping fragments and each was sequenced. The…
A: Introduction DNA is an organic chemical that contains genetic information as well as instructions…
Q: A cloned fragment of DNA was sequenced by using the dideoxy method. A part of the autoradiogram of…
A: Sanger sequencing, often called chain-termination sequencing, is a DNA sequencing technology…
Q: How many fragments are produced if ddT is added to the following DNA segment during Sanger…
A: DNA is arranged in a specific sequence of nucleotides. The sequence consists of four types of…
Q: If a sample of double-stranded DNA gave the following results, what is the concentration (ng/uL) of…
A: The absorption value of 1 at A260 corresponds to 50 ug/ml So, the value of 1.637 at A260 corresponds…
Q: A researcher wants to cut this piece of linear DNA. 5 AGCTAGTCCGGATCCGAGGGCCCTTCTCATGAGATCCGGATGACC…
A: The discovery of restriction enzymes in 1968 by Swiss scientist "Werner Arber" ushered in the era of…
Q: The original DNA template starts with T following the primer sequence if the smallest fragment…
A: Dideoxy nucleotides are similar to regular, or deoxy, nucleotides, but they lack a 3’ OH group.…
Q: Which of the following is true regarding next generation sequencing? 1. Next generation sequencing…
A: Answer Next generation sequencing is a powerful platform that has enabled the sequencing of…
Q: A student carries out PCR using the following steps: step 1: 94C for 1 minute Step 2: 60C for…
A: A complete set of chromosomes in any species is regarded as its genome. Each chromosomes homes DNA…
Q: A 3000 bp circular DNA was treated with both HindIII and EcoRI restriction enzymes. EcoRI cuts at…
A: In this question, we are given two restriction enzymes EcoRI and HindIII with their restricting…
Q: The segment of DNA shown in the figure has restriction sites I and II, which create DNA restriction…
A: The segment of DNA shown in the figure has restriction sites I and II, which create DNA restriction…
Q: A researcher wants to cut this piece of linear DNA. 5'…
A: The restriction enzymes are the specific enzymes that act on the DNA molecule and perform its…
Q: In E.coli, the following enzymes do NOT synthesize the RNA primer for Okazaki fragments?
A: Introduction:- E.coli,like most bacteria, has a single origin of replication on its chromosome. As…
Q: Order the following steps according to the Sanger sequencing method The bands in the electrophoresis…
A: DNA sequencing is a technique used to evaluate the exact nucleotide bases , their position as well…
Q: A DNA probe with sequence TCAGGCTTCAG would bind most strongly to which of the following DNA…
A: Gene probes are small, single-stranded DNA or RNA that hybridize with the target DNA sequences in a…
Q: Examine the sequence for the DNA fragment below. Your job is to design primers for PCR that would be…
A: A primer may be a brief single-stranded nucleic acid utilized by all living living beings within the…
Q: Which of the following best describes the process of DNA seqencing.
A: DNA is mainly made up of the nucleotide and also contains genetic information in the genes. Every…
Q: A linear piece of DNA was broken into random, overlapping fragments and each fragment was sequenced.…
A: An overlapping gene fragment is a gene whose nucleotide sequence partially overlaps with that of…
Q: 17. You are presented with the following DNA molecule: 5 ATGCGATTATAA 3' 3' TACGCTA ATATT5' A. Write…
A: Given: A DNA Molecule: 5' A T G C G A T T A T A A 3' 3' T A C G C T A A T A T T 5' DNA =>…
Q: Sequencing reactions are done in separate tubes for each ddNTP with a radioactive primer. Which…
A: In our Desire primer it is 15 nucleotide long however on gels there are only 10 bands are present…
Q: Please draw the DNA denaturation (DNA melting) curves corresponding to the three molecules and…
A: DNA denaturation is the breaking down of DNA molecule, for comparison or sequencing. DNA can be…
Q: Sanger DNA sequencing/ dideoxy sequencing was used as shown in the diagram below. The arrow…
A: Sanger's sequencing method. It is a method based on DNA synthesis. In normal DNA synthesis,…
Q: A) For this DNA fragment "TGAATTCCCGGGTTCCGGGAATTCGCGCGAATT CCCGGTATA", what is its complementary…
A: DNA (deoxyribonucleic acid) is a double-stranded nucleotide sequence that is intertwined and…
Q: The following DNA fragment was sequenced by the Sanger method. The red asterisk indicates a…
A: DNA polymerase is an enzyme that catalyzes the synthesis of DNA molecules from nucleoside…
Q: The chromatogram shows fluorescent peak data from a dye-terminating nucleotide-sequencing reaction.…
A: Sanger sequencing (also known as chain termination sequencing) is a DNA sequencing technology that…
Q: See the restriction enzyme map below. The total DNA length is 1800 base pairs. If this DNA is cut…
A: An enzyme derived from bacteria that cuts DNA molecules at specified sequences is known as a…
Q: The diagram shows an autoradiograph of a DNA sequencing gel. What is the 5' to 3' sequence of the…
A: Gel electrophoresis is a technique which is used to separate the molecules based on the size of the…
Q: Suppose that you are given a short fragment of DNA to sequence. You amplify the fragment with PCR…
A: Gel electrophoresis refers to the separation technique that involves the separation of charged…
Q: A linear piece of DNA is cut as follows: cut with Ecorl - get 1kb and 4 kb band Cut with Bamhl - get…
A: Ans- According to question For linear DNA – Upon Cutting by for Eco R1 it formed – 1kb and 4kb =…
Q: . The DNA polymerases are positioned over the following DNA segment (which is part of a much larger…
A: Introduction DNA replication is very crucial process for the continuation of life as every new…
Q: Which of the sequences below would serve as a PCR primer that would bind this DNA strand: 5'-…
A: PCR is polymerase chain reaction. It is a method of DNA amplification developed by Kerry Mullis.…
Q: Below is a nucleotide base pair from B-DNA with three different regions indicated by A, B, and C. B…
A: B- DNA is the most common form of DNA. It is the right-handed helix and is present in humans which…
Q: In lane 1, a size standard was loaded, which contained a mix a DNA fragments known to be 1000 bp,…
A: Gel electrophoresis is a gel technique that uses an applied electrical field to separate nucleic…
Q: A DNA synthesizer “machine” is used to create short single stranded DNA of any given sequence. You…
A: A Deoxyribonucleic acid (DNA) synthesizer machine used for generating shorter segments of DNA that…
Q: Which of the following is the correct order in extracting the DNA? I. Washing of DNA II. Tissue…
A: DNA act as genetic material in most of organism . It is two stranded , ladder like structure . DNA…
Q: If a mutation that alters EcoRI site 1 occurs in this piece of DNA, how will the banding pattern on…
A: The restriction enzyme is a protein that identifies a specific nucleotide sequence and cuts the DNA…
Q: A small DNA molecule was cleaved with several different restriction nucle- ases, and the size of…
A: Introduction: DNA is a type of nucleic acid that is present in the nucleus of the cell. It is the…
Q: The restriction enzyme Haelll has the recognition sequence below and cuts between the G and bases.…
A: restriction enzymes are the specific endonucleases that have a specific site within the DNA sequence…
Q: During a typical gel electrophoresis set up (negative pole at the top), which DNA fragment would be…
A: The answer is 100 kb .
Q: Following agarose gel electrophoresis, where on the gel will the largest DNA molecules be, and why?…
A: in agarose gel electrophoresis the agarose gel is poured on the electrophoresis plate and wells are…
Q: A cloned fragment of DNA was sequenced by using thedideoxy chain-termination method. A part of the…
A: The process is usually defined as the way that they are been determining the sequence of nucleotides…
Q: If insert DNA was obtained by PCR using Taq DNA polymerase, what shape does the end of this DNA…
A: Taq polymerase is basically a thermostable polymerase that is obtained from the bacteria called as…
Q: Suppose that you are given a short fragment of DNA to sequence. You amplify the fragment with PCR…
A: DNA sequencing is a method to determine the sequence of the DNA molecule. Electrophoresis enables…
Q: The diagram illustrating the polymerase chain reaction (PCR) technique is provided below. How does…
A: Polymerase chain reaction (PCR) is a technique used to produce a large number of copies of a…
Q: Suppose that you want to sequence the following DNA fragment: 5′–TCCCGGGAAA-primer site–3′ You first…
A: The sequencing involves replicating the desired sequence to be sequenced in the presence of the…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- For the following short sequence of double stranded DNA and the given primers, there will be one major duplex DNA product after many cycles (imagine 10 cycles) of PCR. Provide the sequence of this one major duplex product and label the 5’ and 3’ ends of each strand. Sequence to be amplified: 5’- GGTATTGGCTACTTACTGGCATCG- 3’ 3’- CCATAACCGATGAATGACCGTAGC- 5’ Primers: 5’-TGGC-3’ and 5’-TGCC-3’A piece of DNA fragment is sequenced. You clone the the fragment, isolate the cloned DNA fragment, and set up a series of four dideoxy reaction. You then separate the products of the reaction by gel electrophoresis and obtain the following banding patter: ddATP ddTTP O 5'-ATTCGACT-3' O 5'-TCAGCTTA-3' What is the base sequence of the synthesized fragment? O 5'-AGTCGAAT-3' ddCTP O 5'-TAAGCTGA-3' I ddGTPThe chromatogram shows fluorescent peak data from a dye-terminating nucleotide-sequencing reaction. The peaks are shown with shortest fragment on the left to longer fragments on the right. T •C A Select the DNA sequence that matches the data. 5-ТАТAСТТАСGAAGT-3' 5'-GTCCTACGGACGCG–3' 5'-ATATGAATGCTTCA–3' 5'-TGAAGCATTCATAT–3' 5-АСТТCGTAAGTATA-3'
- You digest 4 uL of plasmid DNA that is 50 ng/uL concetration in a total volume of 20 uL. You run 10 uL of the digest on teh gel. You then do a DNA purification protocol with a Zippy prep on the remaining digested DNA. You elute the DNA in a 25 uL. A 2 uL ssample has the concentration of 2 ng/uL. What is the DNA yield?The partial sequence of one strand of a double-stranded DNA molecule is5′ – – – GACGAAGTGCTGCAGAAAGTCCGCGTTATAGGCATGAATTCCTGAGG – – – 3′The cleavage sites for the restriction enzymes EcoRI and PstI are shown below.Write the sequence of both strands of the DNA fragment created when this DNA is cleaved with both EcoRI and PstI. The top strand of your duplex DNA fragment should be derived from the strand sequence given aboveA DNA strand was sequenced using the Sanger method (https://www.youtube.com/watch?v=KTstRrDTmWI). The reaction tube contained the DNA strand, fluorescently labelled dideoxynucleotide triphosphates (ddATP – yellow, ddGTP – green, ddCTP – blue, ddTTP - red), deoxynucleotide triphosphates, DNA polymerase, or its Klenow fragment. Synthesis of DNA is allowed to proceed, and the results are shown on the right: 15 14 13 12 11 10 (a) What is the sequence of the copy and the template strands? (b) If the template strand were in the 5'-3' direction, what will be the sequence of the DNA copy? Nucleotide Length
- In a standard procedire, when writing and reading base sequences for nucleic acids (both DNA and RNAs) always to specify base sequence in 5' > 3' direction unless otherwise directed 1. From the base sequence 5' A-T-G-C-C-A 3' in a DNA template strand, determine the base sequence in hnRNA synthesized from the DNA template strand 2. From the base sequence 5' T-A-A- C-C-T 3' in a DNA template strand, determine the base sequence in hnRNA synthesized from the DNA template strandYou digest 4 uL of plasmid DNA that is 50 ng/uL concetration in a total volume of 20 uL. You run 10 uL of the digest on teh gel. You then do a DNA purification protocol with a Zippy prep on the remaining digested DNA. You elute the DNA in a 25 uL. A 2 uL ssample has the concentration of 2 ng/uL. What is the DNA yield? YIELD = How much dna came out of the column/how much DNA was loaded onto the columnRemember to subtract amount of DNA run on gel from total digested DNA to get hw much DNA was loaded onto the columnAmount that came out of the column equals the volume of the eluted DNA times the concentration of the purified DNAFor the following short sequence of double stranded DNA, design primers (just ~ 3-4 bases) and show 2 copy cycles of PCR (refer to figure 13.25) for the amplification of this sequence of DNA (so that you have 4 double stranded DNA). 5’- GGTATTGGCTACTTACTGGCATCG- 3’ 3’- CCATAACCGATGAATGACCGTAGC- 5’
- The short DNA shown below is to be sequenced. Using your knowledge of how the Sanger method works, in the gel diagram, draw in the bands that will appear when DNA polymerase is added to the reaction along with the four different nucleotide mixtures indicated. Note that some of these mixtures are not what would normally be used in a sequencing reaction. Dideoxynucleatides (ddNTPs) are added in relatively small amounts. The asterisk represents a radioactive label. *5' - 3'-ОН 3' – -- ACGACGCAGGACATTAGAC-5' Nucleotide mixtures: A. DATP, DTTP, dCTP, DGTP, ddTTP (given) B. DATP, ATTP, dCTP, AGTP, ddATE C. dTTP, dGTP. ACTP, ddCTP, ddATP D. DATP, dCTP, dTTP, ddGTP A в с D | || ||In the following gel showing stained bands of the Alu insertion sequence, what is the genotype of individual 2? 941 bp 641 bp->>> 1 2 3 4 5 6 Homozygous for the 641 bp sequence that does not contain in the Alu insertion Heterozygous, containing one 941 bp sequence and one 641 bp sequence O Homozygous for the 941 bp sequence containing the Alu insertionThe partial sequence of one strand of a double-stranded DNA molecule is 5'-GACGAAGTGCTGCAGAAAGTCCGCGTTATAGGCATGAATTCCTGAGG -3' EcoRI is a restriction enzyme that cleaves after G in the sequence 5'-GAATTC-3'. PstI is a restriction enzyme that cleaves after A in the sequence 5'-CTGCAG-3'. Write the sequence of both strands of the DNA fragment created when this DNA is cleaved with both EcoRI and PstI. The first strand of your duplex DNA fragment should be derived from the given strand sequence. 5'- -3' 3'- -5'