BamHI Haell Both 10 kb 9 kb 8 kb 5 kb 2 kb 1 kb Figure 2 (i) How long is the original DNA molecule? (ii) Does the longest BamHI fragment contain a Haelll restriction site? Explain your answer.
Q: What is the role of di-deoxy DNTPs in a Sanger sequencing reaction? Please select the answer that…
A: Sanger sequencing is a method which helps in termination of chain and determining the nucleotide…
Q: ques 1 . A small DNA molecule was cleaved with several different restriction nucleases, and the size…
A: Due to our answering policy, we can only answer one question at a time. Therefore, please repost the…
Q: You have the plasmid pUC18/19, which is a circular plasmid that consists of 2686 bp. What would the…
A: Restriction enzymes are molecules that cleave nucleic acid (DNA) at a specific sequence. Restriction…
Q: Some restriction endonucleases produce blunt-ended pieces of DNA, while other produce DNA fragments…
A: DNA (deoxyribonucleic acid) is the unit of an organism. The DNA is inherited from the parent…
Q: Figure 9-22 shows the first steps in the process of making a DNA microarray, or DNA chip, using…
A: A DNA microarray is also known as the DNA chip, is the high throughput method that is used to trace…
Q: In making recombinant DNA molecules that combine restriction fragments from different organisms,…
A: Restriction enzymes are the endonucleases that cleave the DNA.
Q: The total (50ul) of your restriction digest contains 500ng of DNA how much DNA (ng) are you loading…
A: The amount of DNA extracted depends on the sample's quality and the number of cells in it.…
Q: Restriction enzymes and DNA ligase play essential roles in DNA cloning. How is it that a bacterium…
A: Deoxyribonucleic acid (DNA) is a particle made out of two polynucleotide chains that loop around one…
Q: A linear piece of DNA was broken into random, overlapping fragments and each was sequenced. The…
A: Introduction DNA is an organic chemical that contains genetic information as well as instructions…
Q: Consider the λ bacteriophage DNA molecule as shown in Figure 21.14. Total digestion with the two…
A: DNA or deoxyribonucleic acid is a type of biomolecule. It is a polymer of deoxyribonucleotides…
Q: Transcribe and translate the following DNA sequence (nontemplate strand);…
A: The gene is expressed into protein by the transcription and translation step.
Q: The following is the base sequence of DNA that codes for first eight amino acids of the β chain of…
A: 1. Each amino acid corresponds to a codon and each codon is made up of sequence of three nucleotide…
Q: BamHI Haelll Both 10 kb 9 kb 8 kb 5 kb 2 kb 1 kb Figure 2 How long is the original DNA molecule?
A: If it is a closed circular DNA, BamH1 cut it into three fragments of length 10kb 5kb 2kb
Q: The partial sequence of one strand of a double-stranded DNA molecule is…
A: Restriction endonucleases are the enzymes used in genetic engineering or DNA cloning in which…
Q: 1. You have the plasmid pUC18/19, which is a circular plasmid that consists of 2686 bp. What would…
A: As per our guidelines, we are supposed to answer only one question. Kindly repost the other question…
Q: The 50ul of your restriction digest contains 500ng of DNA how much DNA (ng) are you loading into the…
A: DNA yield (µg) = DNA concentration × total sample volume (ml) Usually we need : Restriction…
Q: Examine the DNA sequence shown below. You have been tasked with designing Primers for PCR…
A: Polymerase chain reaction (PCR) is a method used to make millions of copies of a specific DNA…
Q: Figure 25: MCS of PUC19 A. If the MCS were cut with Kpn I and BamH I, draw the small fragment of DNA…
A: pUC19 is a plasmid cloning vector developed by Joachim Messing. It is a 2686 base pair containing…
Q: Proofreads each nucleotide its template as soon as it is added to the growing strand. A) DNA Ligase…
A: DNA is a genetic material that uses transcription and translation to transfer genetic information to…
Q: Examine the sequence for the DNA fragment below. Your job is to design primers for PCR that would be…
A: A primer may be a brief single-stranded nucleic acid utilized by all living living beings within the…
Q: Examine the DNA sequence shown below. You have been tasked with designing Primers for PCR…
A: Polymerase chain reaction (PCR) is a method widely used to make many copies of a specific DNA…
Q: CHOICES: Isoniazid Rifampicin Ethambutol None of the Choices Binds to bacterial DNA gyrase &…
A: DNA gyrase is an important enzyme that allows the bacteria to supercoil its NDA. The DNA gyrase is…
Q: The sequence of a region of interest in a DNA template strand is3′–ATACGACTAGTCGGGACCATATC–5′. If…
A: DNA sequencing is used to determine the exact arrangement of the nucleotide bases adenine (A),…
Q: Using this strand of DNA (TACAACTGA), show what a substitution would look like”
A: Substitution is a type of genetic mutation in which there are three possibilities after the…
Q: 7. A 1000 bp EcoRI restriction fragment contains a gene you are interested in. The fragment was…
A:
Q: Question: What restriction sites are you going to add at the ends of the gene? Answer can be in…
A: INTRODUCTION The COVID-19 pandemic, also referred to as the coronavirus pandemic, is an ongoing…
Q: Looking at each of the fragments (100, 200, 300 base pairs etc.). Why are there so many of the…
A: Restriction fragment length polymorphism (RFLP) is a type of polymorphism that results from…
Q: Assume complete digestion of a single linear piece of DNA digested (cut) with EcoRI and Hindill.…
A: A plasmid is a single-stranded, circular DNA molecule that is different from the chromosomal DNA of…
Q: Primer designing: A single-stranded DNA sequence (963 nucleotides) that codes for a hypothetical…
A: ANSWER;- Forward primer:Sequence = 5'-CT-GAATTC-ATGGCTAAAGGCGGAGCT-3'Length = 18 ntdGC content =…
Q: What is the dna strand sequence for phosphate sugar backbone?
A: Disclaimer: - According to Bartleby guidelines only the 1st question can be answered when multiple…
Q: Restriction sites are palindromic; that is, they read the same in the5' to 3' direction on each…
A: Restriction enzymes also called molecular scissors are originally a part of a bacterial defence…
Q: Sample Gel Electrophoresis: A brother and sister's DNA are cut with the same restriction enzyme and…
A: Gel electrophoresis is a technique used to separate DNA fragments according to their size.
Q: In a genome project, the following genomic DNA sequences were obtained. Assemble the sequences into…
A: Genome of an organism includes all the cellular DNA of the organism; including nuclear, chloroplast…
Q: A 10 kb DNA fragment digested with the restriction endonuclease EcoRI yields fragments of 4 kb and 6…
A: Restriction enzymes are also known as restriction endonucleases. These are the enzymes produced by…
Q: 5. A scientist was studying a fragment of eukaryotic DNA that she suspected was involved in a…
A: A restriction endonuclease or restriction enzyme is a bacterial enzyme that cuts dsDNA into…
Q: Sample Gel Electrophoresis: A brother and sister's DNA are cut with the same restriction enzyme and…
A: Gel electrophoresis is used to separate the DNA fragments on the basis of their size.
Q: 1. A linear DNA molecule is subjected to complete restriction digestion by (1) EcoR1 alone, (2)…
A: Restriction enzyme or restriction endonuclease are bacterial protein that cleaves DNA at specific…
Q: During electrophoresis, DNA molecules can easily be separatedaccording to size because all DNA…
A: Introduction The technique of gel electrophoresis is used to separate DNA fragments based on their…
Q: A small DNA molecule was cleaved with several different restriction nucle- ases, and the size of…
A: Introduction: DNA is a type of nucleic acid that is present in the nucleus of the cell. It is the…
Q: How does that length compare to that of restriction enzymes? Implications?
A: Answer- Restriction enzyme is also called as molecular sisscors because it is used to cut the DNA…
Q: Explain why DNA fragments migrate in a gel electrophoresis. Which fragments migrate farthest: large…
A: Introduction :- The technique of gel electrophoresis is used to separate DNA fragments based on…
Q: Image 1. Which 2 primers from the choices provided would work to amplify the DNA sequence given…
A: DNA strand for deoxyribose nucleic acid. It is the genetic material present in the cell.
Q: You have the plasmid pUC18/19, which is a circular plasmid that consists of 2686 bp. What would the…
A: A restriction endonuclease, also known as a restriction enzyme, is a bacterial enzyme that…
Q: 1. You have a circular plasmid (PUC57), which consists of 2710 bp. What would the number and length…
A: If we cut a circular plasmid at 2 sites then 2 fragments would be generated. Similarly, for 3 cut…
Q: 1. You have the plasmid pUC18/19, which is a circular plasmid that consists of 2686 bp. What would…
A: Hello. Since your question has multiple parts, we will solve the first question for you. If you want…
Q: HELP EMAIL • a DNA ladder with markers every 200 bp (DNA Ladder) • the resulting restriction…
A: Restrictions enzyme or endonuclease are the enzyme which cleaves the DNA at specific restrictions or…
Q: Suppose that you want to sequence the following DNA fragment: 5′–TCCCGGGAAA-primer site–3′ You first…
A: The sequencing involves replicating the desired sequence to be sequenced in the presence of the…
Q: What size DNA fragment would be released after very mild digestion of chromatin with micrococcal…
A: Introduction Micrococcal nuclease in as example of endo-exonuclease which is obtained from…
i
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- A) For this DNA fragment (from 5' to 3') "TGAATTCCCGGGTTCCGGGAATTCGCGCGAATTCCCGGTATA", what is its complementary strand B) What are the products when the DNA with the above sequence is incubated with the restriction enzyme EcoRI C) What are the products when the DNA with the above sequence is incubated with the restriction enzyme Mspl D) Draw the first two (2) base pairings of the DNA molecule from the 5' end and label all key elements of the molecule including the bonds involvedA 12 kb linear DNA fragment is subject to single or double RE digest and agarose gelelectrophoresis, to yield the gel profile shown below. The first lane contains the size marker(M).a) Explain how the name of the enzyme EcoRI is derived.b) How many sites are there for EcoRI and PvuII respectively on this DNA fragment?c) Use the sizes of the DNA bands on the gel to compile a restriction enzyme map of the DNAfragment. Indicate the positions of the restriction enzymes sites for EcoRI and PvuII on themap.A small DNA molecule was cleaved with several different restriction nucleases, and the size of each fragment was determined by gel electrophoresis.The following data were obtained. (a) Is the original molecule linear or circular?(b) Draw a map of restriction sites (showing distances between sites) that isconsistent with the data given.(c) How many additional maps are compatible with the data?(d) What would have to be done to locate the cleavage sites unambiguouslywith respect to each other?
- If a 1000 bp of DNA were inserted between the two restriction sites, how would the banding pattern on the gel differ from the one you drew in part a? (PART A WITH THE FIRST PART OF THE QUESTION IS ATTACHED)A small DNA molecule was cleaved with several different restriction nucle- ases, and the size of each fragment was determined by gel electrophoresis. The following data were obtained. Enzyme Fragment Size (kb) EcoRI 1.3, 1.3 Hpall 2.6 HindlII 2.6 ЕcoRI + Hpall ECORI + HindlII 1.3, 0.8, 0.5 0.6, 0.7, 1.3 (a) Is the original molecule linear or circular? (b) Draw a map of restriction sites (showing distances between sites) that is consistent with the data given. (c) How many additional maps are compatible with the data? (d) What would have to be done to locate the cleavage sites unambiguously with respect to each other?When joining two or more DNA fragments, a researcher can adjust the sequence at the junction in a variety of subtle ways, as seen in the following exercises.(a) Draw the structure of each end of a linear DNA fragment produced by an EcoRI restriction digest (include those sequences remaining from the EcoRI recognition sequence).(b) Draw the structure resulting from the reaction of this end sequence with DNA polymerase I and the four deoxynucleoside triphosphates.(c) Draw the sequence produced at the junction that arises if two ends with the structure derived in (b) are ligated (d) Draw the structure produced if the structure derived in (a) is treated with a nuclease that degrades only single-stranded DNA.(e) Draw the sequence of the junction produced if an end with structure (b) is ligated to an end with structure (d).(f) Draw the structure of the end of a linear DNA fragment that was produced by a PvuII restriction digest (include those sequences remaining from the PvuII recognition…
- 1) Restriction enzymes come in a concentration of U/ml, and it is recommended that 1U be used for each ug of DNA to be digested. If an enzyme you want to use comes in at 22,000 U/ml, and you want to digest 5 ug of DNA. How much volume will you have to use for the reaction and how will you be able to measure it with the pipettes we have in the lab? 2) An enzyme for ligation (Cip) comes at a concentration of 16000 units/ml. How many units will there be in 10 ul?The restriction endonuclease NciI recognizes and cuts the five-base-pair sequence 5’- CC(G/C)GG-3’ [where (G/C) means either G or C will work at that position]. (1) How often, on average, would this sequence occur in random DNA? Assume the DNA contains 25% each of A, G, T & C. (2) After digestion, Nci1 leaves a one-base 5’ overhang. Write/draw the cut site/digested products.Restriction sites are palindromic; that is, they read the same in the5' to 3' direction on each strand of DNA. What is the advantage ofhaving restriction sites organized this way?
- Restriction endonuclease digestion of a DNA sequence yielded fragments of the following sizes: 1. 5.2 kb 2. 0.8 kb 3. 1.2 kb 4. 3.8 kb 5. 3.1 kb After gel electrophoresis, what would be the order in which these fragments would be found—the last fragment listed being furthest from the negative pole.When circular DNA is sequenced, the nucleotide base pairs are numbered starting from a fixed position on the DNA, all the way around, usually in a clockwise manner. a DNA molecule that is 3133 base pairs long is digested with RsaI restriction enzyme recognition sites at base numbers 366, 1534, and 2207. What are the sizes of the DNA fragments that will be produced after the DNA is digested with RsaI?If a 500 bp of DNA between the two restriction sites were deleted, how would the banding pattern on the gel differ from the one you drew in part a? (PART A WITH THE FIRST PART OF THE QUESTION IS ATTACHED)