Q: The following is the base sequence of DNA that codes for first eight amino acids of the β chain of…
A: As per the bartleby guidelines experts are allowed to answer only 3 sub-parts for a question. The…
Q: Explain The DNA Code in 200-300 words.
A: Please follow step 2 for detailed explanation.
Q: What is the polypeptide that will be formed from the following DNA sequence? Template DNA…
A: In molecular biology complementary base pairing or complementarity is a reletion between the two…
Q: ONA sequences have an alphabet {A, C,G,T}. How many DNA sequences of length n are there? (Two DNA…
A: Dna is a nucleic acid polymer made of deoxyribonucleotides. It is a bit like a string of letters…
Q: What enzyme is combining two DNA fragments together? 5' 3' -Template Strands Replication Fork 3' DNA…
A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question…
Q: SOURCE: GENERAL, ORGANIC AND BIOLOGICAL CHEMISTRY by Smith 4th Edition
A: DNA is the genetic material that carries genetic material in the form of coded nucleotide sequences.…
Q: 2. 3. Original - (template) DNA Adenine Thymine Cytosine Guanine 7._ Original (template) DNA strand
A: DNA replication is the process which produces daughter dsDNA from the parental dsDNA. It takes place…
Q: What type of DNA assembly all occurs at 50 degrees C so the complementary bases at each fragment…
A: DNA assembly is the term that refers to the linking of numerous fragments of DNA end-to-end that…
Q: If pET32a(+) is digested simultaneously with SacI and Bc1I 1. How many fragments are created? 2.…
A: A restriction enzyme or restriction endonuclease is an enzyme that cleaves/cuts DNA into fragments…
Q: What allows the peaks to be different colors?
A: DNA sequencing refers to the determination of the nucleotide sequence in the DNA molecule. Automated…
Q: How many fragments are produced if ddT is added to the following DNA segment during Sanger…
A: DNA is arranged in a specific sequence of nucleotides. The sequence consists of four types of…
Q: Watson and Crick
A: Introduction:- James Watson and Francis crick marked a milestone in the history of science and gave…
Q: In computer science, a bit stores one of two states, 0 or1. A byte is a group of 8 bits that has 28…
A: The word “Genome” defines the total genetic content of an organism. It is able to provide the…
Q: Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that…
A: Mutation is defined as the change in the nucleotide sequence of DNA.
Q: What is the first genetic material? A) M-DNA B) R-DNA. C) RNA.
A:
Q: Which one of the following options would be a good way to identify the location of the poly A tail…
A: Pre mRNA undergoes several post-transcriptional modifications. One of these modifications is…
Q: A medium-sized human chromosome contains about 100 millionbp. If the DNA were stretched out in a…
A: → Given that , human chromosome medium-sized containsabout 100 million np base pairs.each turn has…
Q: Suppose the following base sequence was found in a segment of one strand of a DNA molecule: 3’…
A: Since you have asked a question with multiple sub-parts, we will solve the first three sub-parts for…
Q: Write a double-stranded DNA sequence that is 20 base pairs inlength and is palindromic.
A: The palindromic sequence refers to the type of sequence in which the sequence is same on each strand…
Q: Q. 1 kbps is same as ___________ Bps.
A: Bps means base pairs. Base pairing occurs in double-stranded DNA and RNA. DNA is deoxyribonucleic…
Q: If a protein was made up of 12 amino acids, how many nucleotides would make up the DNA message…
A: DNA( Deoxyribonucleic acids) is made up of two polynucleotide chain that winds around each other and…
Q: The genome of an organism contains 35% adenine. What percent of the bases are cytosine? A. 15% B.…
A: Chargaff's rules say that the ratio of pyrimidine and purine bases must be 1:1 for DNA. The number…
Q: -35 sequence Pribnow box 5' GATTCCGTATTACAGCATAGGCTATATTCACGTGGTACGCTA 3' 3'…
A:
Q: Match each of the terms in the left column to the bestfitting phrase from the right column.a. exome…
A: a. Exome: It is the part of a genome that contains all the exons.b. de novo gene: These are the new…
Q: Whatis the purpose of the dideoxynucleotides in DNA sequencing? OCH2 base - OCH2 base H. H. H. H. H.…
A: ddNTP(dideoxynucleotide triphosphate) used in sanger dna sequencing .which terminate the…
Q: TACAGAGATAACCGAATT A. Write the corresponding strand that would form the other half of the DNA…
A: Phosphodiester linkages connect DNA strands, which are polymers or chains of deoxynucleoside…
Q: ENE 2: Nose Style DNA Template Strand ATG- GGG- CTT- CTC- TTT MRNA tRNA Amino Acids APPEARANCE
A: Above table is codon anti-codon table for translation of DNA code into protein sequence.
Q: The following double stranded DNA fragment was double digested with BamHI and Kpnl. If you ran the…
A: Restriction enzymes are the enzymes which cut the DNA at specific sequences. The specific sequence…
Q: non-coding DNAs can be put into two groups
A: Part of DNA that does not encode a protein sequence is called as non coding DNA. tRNA, rRNA and…
Q: (AKS 8a2 DOK 2) Some students in the biology classes at Meadowcreek HS analyzed DNA on a gel. The…
A: DNA fragments are negatively charged, so they move towards the positive electrode. Because all DNA…
Q: If pET32a(+) is digested simultaneously with BamHI and BclI, 5.1. How many fragments are created?…
A: pET-32 is a unique sequence outlined for cloning and high-standard peptide sequences expression.
Q: If you had the RNA sequence below: 5' UUUGGAG 3' and you were going to make a piece of DNA that…
A: DNA is a molecule discovered in the nucleus by Friedrich Meischer in the late 1860s, but its…
Q: dna nucleotide sequence ATCGGATCGA What structure of dna does the sequence represent
A: DNA is the genetic material in all the living organisms.
Q: ween a DNA l
A: DNA Library : It is the collection of DNA sequences from different organisms. cDNA : It is the DNA…
Q: Genetics Attached is a segment of DNA (doublestranded). Answer the following questions about the…
A: Open reading frame is a part of genetic material which is responsible for expressing itself in the…
Q: BamHI Haell Both 10 kb 9 kb 8 kb 5 kb 2 kb 1 kb Figure 2 (i) How long is the original DNA molecule?…
A: Restriction digestion is a process in which DNA is cut at specific sites,
Q: Mutated DNA Template Strand #1: 3’-T A C T G T C T G A C G A T C-5’ Complementary DNA sequence: mRNA…
A: DNA molecule is the genetic material present in the animals. Genetic material is present in the…
Q: Which of the following pairs do not match? O DNA has an antiparallel : direction with 5'-phosphate…
A: DNA is composed of nucleotides which are composed of nitrogenous bases, a pentose sugar, and…
Q: How many base pairs are there in a 6.8 nanometer DNA sequence? A. 5 B. 10 C. 15 D. 20
A: The base pairs in DNA can be calculated using the formula; Length of the given DNA = Distance…
Q: The sequence below is one strand from a double-stranded DNA molecule. How many hydrogen bonds hold…
A: In a double-helix, DNA is made up of two strands of nucleotide or nitrogenous bases which are…
Q: Calculate how long a DNA molecule of 1 kb would be
A: Deoxyribonucleic acid (DNA) It is one of the genetic material which have two polynucleotide chains.…
Q: list the RNA sequence transcribed from the DNA template sequence TTACACTTGCTTGAGAGTC
A: DNA is a double-stranded molecule that stores the genetic information in the form nucleotide…
Q: Translate the following opposite strand of DNA based on the nucleotide bases. ATTGACTGG
A: The genetic code is a series of three-letter nucleotide combinations called codons, each…
Q: Consider the following DNA molecule: ACG GTACACTTAC GA A T GCCAT G T GA A TG CTT 1) Draw the 2…
A: DNA stands for deoxyribonucleic acid. It is a nucleic acid, a polymer of nucleotides. A nucleotide…
Q: Here is the nucleotide sequence of an imaginary strand of DNA: 5’ AATTGGCCATGC 3’. If this strand of…
A: DNA (deoxyribonucleic acid) was discovered by Friedrich Miescher. Nucleotides are the structural…
Q: Using Chargaff’s rule of base pairing determine the amount of guanine in 120 bp long fragment of…
A: According to Chargaff's rules, DNA from every species of any organism should have a 1:1…
Q: Using the gel image: the three brightest fragments in the ladder are 100 bp, 500 bp, and 1000 bp in…
A: The gel electrophoresis is a method used to separate different fragments of DNA on the basis of…
Q: How many hydrogen bonds are present in a DNA double helix fragment consisting of the following…
A: DNA is a nucleic acid molecule made of monomer units called nucleotides. The nucleotides forming DNA…
Q: What is the length of DNA in the nucleus of a human muscle cell? a) 3 billion bp b) 1.5 billion bp…
A: In human 23 pairs of chromosomes are present in the nucleus of cell. Chromosomes are made up of DNA…
iii
Step by step
Solved in 2 steps
- A linear DNA molecule is subjected to complete restriction digestion by (1) EcoRI alone, (2) HindIII alone, and (3) both enzymes together. The DNA fragments are then separated using gel electrophoresis. Results are shown below: (i) (ii) (iii) EcoRI Hindill Both | | — | | 10 kb 9 kb 8 kb 5 kb 2 kb 1 kb How long is the original DNA molecule? How many EcoRI recognition sites does it have? Does the longest EcoRI fragment contain a HindIII restriction site? Explain your answer.A 12 kb linear DNA fragment is subject to single or double RE digest and agarose gelelectrophoresis, to yield the gel profile shown below. The first lane contains the size marker(M).a) Explain how the name of the enzyme EcoRI is derived.b) How many sites are there for EcoRI and PvuII respectively on this DNA fragment?c) Use the sizes of the DNA bands on the gel to compile a restriction enzyme map of the DNAfragment. Indicate the positions of the restriction enzymes sites for EcoRI and PvuII on themap.A small DNA molecule was cleaved with several different restriction nucleases, and the size of each fragment was determined by gel electrophoresis.The following data were obtained. (a) Is the original molecule linear or circular?(b) Draw a map of restriction sites (showing distances between sites) that isconsistent with the data given.(c) How many additional maps are compatible with the data?(d) What would have to be done to locate the cleavage sites unambiguouslywith respect to each other?
- 1) Restriction enzymes come in a concentration of U/ml, and it is recommended that 1U be used for each ug of DNA to be digested. If an enzyme you want to use comes in at 22,000 U/ml, and you want to digest 5 ug of DNA. How much volume will you have to use for the reaction and how will you be able to measure it with the pipettes we have in the lab? 2) An enzyme for ligation (Cip) comes at a concentration of 16000 units/ml. How many units will there be in 10 ul?If a 1000 bp of DNA were inserted between the two restriction sites, how would the banding pattern on the gel differ from the one you drew in part a? (PART A WITH THE FIRST PART OF THE QUESTION IS ATTACHED)A small DNA molecule was cleaved with several different restriction nucle- ases, and the size of each fragment was determined by gel electrophoresis. The following data were obtained. Enzyme Fragment Size (kb) EcoRI 1.3, 1.3 Hpall 2.6 HindlII 2.6 ЕcoRI + Hpall ECORI + HindlII 1.3, 0.8, 0.5 0.6, 0.7, 1.3 (a) Is the original molecule linear or circular? (b) Draw a map of restriction sites (showing distances between sites) that is consistent with the data given. (c) How many additional maps are compatible with the data? (d) What would have to be done to locate the cleavage sites unambiguously with respect to each other?
- When joining two or more DNA fragments, a researcher can adjust the sequence at the junction in a variety of subtle ways, as seen in the following exercises.(a) Draw the structure of each end of a linear DNA fragment produced by an EcoRI restriction digest (include those sequences remaining from the EcoRI recognition sequence).(b) Draw the structure resulting from the reaction of this end sequence with DNA polymerase I and the four deoxynucleoside triphosphates.(c) Draw the sequence produced at the junction that arises if two ends with the structure derived in (b) are ligated (d) Draw the structure produced if the structure derived in (a) is treated with a nuclease that degrades only single-stranded DNA.(e) Draw the sequence of the junction produced if an end with structure (b) is ligated to an end with structure (d).(f) Draw the structure of the end of a linear DNA fragment that was produced by a PvuII restriction digest (include those sequences remaining from the PvuII recognition…The restriction endonuclease NciI recognizes and cuts the five-base-pair sequence 5’- CC(G/C)GG-3’ [where (G/C) means either G or C will work at that position]. (1) How often, on average, would this sequence occur in random DNA? Assume the DNA contains 25% each of A, G, T & C. (2) After digestion, Nci1 leaves a one-base 5’ overhang. Write/draw the cut site/digested products.Restriction sites are palindromic; that is, they read the same in the5' to 3' direction on each strand of DNA. What is the advantage ofhaving restriction sites organized this way?
- Restriction endonuclease digestion of a DNA sequence yielded fragments of the following sizes: 1. 5.2 kb 2. 0.8 kb 3. 1.2 kb 4. 3.8 kb 5. 3.1 kb After gel electrophoresis, what would be the order in which these fragments would be found—the last fragment listed being furthest from the negative pole.When circular DNA is sequenced, the nucleotide base pairs are numbered starting from a fixed position on the DNA, all the way around, usually in a clockwise manner. a DNA molecule that is 3133 base pairs long is digested with RsaI restriction enzyme recognition sites at base numbers 366, 1534, and 2207. What are the sizes of the DNA fragments that will be produced after the DNA is digested with RsaI?If a 500 bp of DNA between the two restriction sites were deleted, how would the banding pattern on the gel differ from the one you drew in part a? (PART A WITH THE FIRST PART OF THE QUESTION IS ATTACHED)