A) For this DNA fragment "TGAATTCCCGGGTTCCGGGAATTCGCGCGAATTCCCGGTATA", what is its complementary strand (from 5' to 3')
Q: You prepared a 7x 10^5x dilution from your bacterial culture, plated 0.2 ml of it on a Petridish and…
A: A colony-forming unit (cfu) is a unit used in microbiology to estimate the number of viable bacteria…
Q: hich of the following play an important role in synthesis of DNA/RNA: a.B-12 b.Folic acid c.Sodium…
A: The RNA is synthesized by RNA polymerase enzymes from a DNA template through DNA transcription.…
Q: Which of the following factors does not pay for the generation of NADH and ATP during steps 6 and 7…
A: The energy system that breaks down carbohydrates into smaller carbon molecules is known as…
Q: Which is true about eukaryotic cDNA? Choose all that apply a. it is single stranded b. it is made…
A: Complementary DNA is abbreviated as cDNA. This form of DNA has a wide range of applications. Genes…
Q: In the Krebs Cycle (Citric Acid Cycle), A 4-carbon compound with a 2-carbon unit to yield a 6-carbon…
A: Kreb cycle/ tricarboxylic acid cycle/ citric acid cylce - occur in matrix of mitochondria.
Q: 2. Draw out a labeled diagram explaining all the following processes: Gel Filtration Chromatography…
A: Gel Filtration Chromatography: Gel Filtration chromatography is method in which molecules in a…
Q: Could I have help with number 3: What biological process is similar in mechanism to soap emulsifying…
A: Introduction: The emulsion is a liquid preparation, that contains a mixture of two or more…
Q: Why is PHC still relevant today?
A: 4. PHC Or Primary health care is a whole-of-society approach towards health and well-being that is…
Q: Question Which of the following activities of DNA pol lis MOST important in proofreading A 5' to 3'…
A: The DNA replication in the newly added base are read by DNA pol I enzyme to check weather the added…
Q: Which of the following is true regarding folate/folic acid: a.Intakes below recommended dietary…
A: Folic acid is B family Vitamin which aids in the formation of healthy new cells in the body. Folic…
Q: How do you compare and contrast the structures between protein and carbohydrates?
A: Biomolecules are carbon-based organic compounds. Biomolecules are primarily made up of carbon,…
Q: Intrinsic RNA chain termination is determined by specific sequences in the DNA called ____ sites.…
A: Termination during transcription occur via 2 methods. Intrinsic termination:- promote termination by…
Q: Use the diagram below to complete the cyclic alpha form of structure V. CH2OH Circle the hemiacetal…
A: The given sugar is D-Galactose. It is the C-4 epimer of glucose. The alpha and beta cyclic forms of…
Q: Which of the following is incorrect concerning protein structure determination by X-ray…
A: Protein structure determination by X-Ray Crystallography: is a technique used to obtain the 3D…
Q: The eukaryotic metallothionein gene promoter consists of all EXCEPT: a. GRE b. MRE c. GC Box d.…
A: Metallothioneins are proteins that have high affinity towards binding heavy metal ions, and its…
Q: What are the two types of polysaccharides that are made up of starch?
A: Polysaccharide which is a type of carbohydrate contains long chain of polymeric carbohydrate which…
Q: 3. In the electron transport chain, electrons are transferred to enzyme complexes. Name the…
A: The electron transport chain occurs in mitochondria. ETC is a pathway in which the reducing…
Q: A drug was developed to inhibit the electron transport chain. How many ATP(s) would be generated by…
A: Metabolism includes biosynthesis/ reduction (an anabolic process) and oxidation (catabolic…
Q: If we take a cholesterol test and the test results are high or low, what are the reasons that led to…
A: Cholesterol is a waxy substance found in your blood. The body needs cholesterol to build healthy…
Q: Pls help ASAP, thank you! "Which features of glucose metabolism & regulation in the liver are…
A: The liver plays important role in maintaining the blood glucose levels in the blood. When the blood…
Q: How many enyzymatic reactions are there in glycolysis pathway?
A: There are 10 enzymatic reactions in glycolysis pathway.
Q: Mechanism for Acid-Base Balance What happens with this mechanism to regulate the body to become more…
A: The bicarbonate/carbonic acid buffer system is found in blood and many other tissues. It balances…
Q: 2. Calculate AG for the exchange of 3 Na* by 2 K* by Na*-K* ATPase (in kJ per mole of ATP) under the…
A: Gibbs free energy change for the exchange of 3Na and 2 K by Na-K ATPase It is a thermodynamic…
Q: CH;OH CH2OH O, H H H. Он H OH OH OH ÓH
A: A disaccharide is composed of two monosaccharide units. Carbohydrates are composed of carbon,…
Q: plasmid cloning vector
A: The term vector refers to the DNA molecules that act as transporting vehicle which carries target…
Q: Which protein standard curve would you use to read off the protein concentration of an unknown…
A: Proteins are composed of twenty standard amino acids attached together via peptide bonds. Protein's…
Q: List a physiological emulsifying agent produced in the liver. What role does this substance play in…
A: Hepatocytes produce bile, which would then be altered by the cholangiocytes that line the bile…
Q: A 44-year-old man diagnosed with acute tubular necrosis has a blood urea nitrogen of 60 mg/dL and a…
A: A heart attack or a heart stroke can cause the tubular necrosis. This is a condition in which the…
Q: for GABA transaminase, ornithine decarboxylase, and alanine
A: PLP-dependent enzymes catalyse a wide range of reactions that result in bond cleavage at the carbons…
Q: What is the purpose of the low temperature step in the PCR reaction? a. To allow DNA polymerase to…
A: The denaturation step of PCR is optimized for high temperatures. The annealing step in PCR is…
Q: In a process of production of a recombinant protein by E. coli cells, it was observed accumulation…
A: Chemical compounds and recombinant proteins are frequently produced commercially using Escherichia…
Q: What are the main functional groups present in carbohydrates? Illustrate and explain.
A:
Q: Does different kinds or types of tea produces different amount of caffeine content? Why? Why does…
A: Caffeine is categorized as a type of a bitter substance. The caffeine occurs in a number of…
Q: Why marathon runners eat a meal rich in carbohydrates the day before the race
A: Nutrients are molecules that aids in the growth and development of living organisms. Nutrients are…
Q: How does salt help in the DNA extraction process?
A: DNA is extracted to compare the DNAs from different sources and to study the sequence differences.…
Q: Which of the following is not a general description of the gene expression regulation mechanisms…
A: Gene expression regulation mechanisms helps to maintain the rate of gene expression or to regulate…
Q: Explain how do you prepare a 25-mL solution of 1 mg/mL cholesterol stock?
A: Given Values: Volume = 25 ml Concentration = 1 mg/ml
Q: Question 11 Match the different carbohydrates' nomenclature/ glycan representation with their…
A: IUPAC-IUBMB, symbol nomenclature, LINUCS, and linear code are different nomenclatures used to name…
Q: Compare and contrast Maillard reaction, caramelization and enzymatic browning in food.
A: A chemical reaction occurs when one or more chemicals (reactants) are converted into one or more…
Q: Identify the monosaccharide below
A: Carbohydrates are largely composed of carbon and water, and most of them have the empirical formula…
Q: ACTIVITY 6.2.4 Give the systematic name of the following cyclic monosaccharides: 1. Name: OH Н OH Н…
A: Monosaccharides are carbohydrates with single sugar unit. The structure of monosaccharides can be…
Q: Search and explain the Watson and Crick model of DNA.
A: Watson and Crick first described the structure of the DNA double helix using X-ray diffraction data…
Q: The reaction is reversible. Check all that apply. acetyl CoA lactate ethanol
A: “Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: Bypass I of gluconeogenesis requires a source of energy. This energy comes from: a oxidation of…
A: Glucose is the primary source of energy for the body, and it is primarily obtained through the diet.…
Q: CREATE A COMPLETE MEAL PLAN FOR BLOOD TYPE A: INCLUDE BREAKFAST, LUNCH, SNACKS AND DINNER CONSIDER…
A: Blood type diet: Dr. Peter D'Adamo, a naturopathic physician, popularised the blood type diet,…
Q: What kinds of effects can occur on cellular metabolism when we introduce genetic modifications into…
A: Metabolism is driven by specific enzymetic products of gene expression , and gene expression…
Q: Why is important to note the Kit / Lot number and expiration date for each kit or tests done from…
A: ELISA is a biochemical analytical technique which enables us to check for the presence of a protein…
Q: How does the degree of unsaturation and structure of fats affects its functionality, for example in…
A: Lipids are not polymers. The simplest form of lipid is fatty acids which are a long chain of…
Q: The major pathway of ammonium assimilation combines two reactions in organisms with rich nitrogen…
A: Introduction: Nitrogen is cycled between organisms and inanimate environments. The principal…
Q: Compare the old (Boot's method) and new (Green) syntheses of Ibuprofen in the light of Green…
A: Introduction: Ibuprofen is a non-steroidal anti-inflammatory drug that is widely used in the…
Step by step
Solved in 2 steps
- A 12 kb linear DNA fragment is subject to single or double RE digest and agarose gelelectrophoresis, to yield the gel profile shown below. The first lane contains the size marker(M).a) Explain how the name of the enzyme EcoRI is derived.b) How many sites are there for EcoRI and PvuII respectively on this DNA fragment?c) Use the sizes of the DNA bands on the gel to compile a restriction enzyme map of the DNAfragment. Indicate the positions of the restriction enzymes sites for EcoRI and PvuII on themap.A small DNA molecule was cleaved with several different restriction nucleases, and the size of each fragment was determined by gel electrophoresis.The following data were obtained. (a) Is the original molecule linear or circular?(b) Draw a map of restriction sites (showing distances between sites) that isconsistent with the data given.(c) How many additional maps are compatible with the data?(d) What would have to be done to locate the cleavage sites unambiguouslywith respect to each other?If a 1000 bp of DNA were inserted between the two restriction sites, how would the banding pattern on the gel differ from the one you drew in part a? (PART A WITH THE FIRST PART OF THE QUESTION IS ATTACHED)
- Restriction sites are palindromic; that is, they read the same in the5' to 3' direction on each strand of DNA. What is the advantage ofhaving restriction sites organized this way?A plasmid DNA and a linear DNA (both of the same size) have one site for a restriction endonuclease. When cut and separated on agarose gel electrophoresis, plasmid shows one DNA band while linear DNA shows two fragments. Explain.The sequences below indicated the 6bp recognition site for the restriction enzyme EcoRI. The lines indicate the sites where the enzyme will cut each strand. 1). write the sequence and structure of the two DNA pieces after the enzyme cuts (hydrogen bonds holding the strands together between the lines are broken after enzyme cuts) 2). indicate whether EcoRI generates blunt or sticky overhangs 5'- G I A A T T C - 3' 3' - C T T A A l G - 5'
- Consider the following plasmid (size 8000 bp), with restriction sites at the positions indicated: (see image) a) This plasmid is digested with the enzymes listed below. Indicate how many fragments will begenerated in each case, and give the sizes of the fragments.PstIXhoICombination of PstI + XhoI + EcoRI (triple digest) b) Draw the banding pattern you would expect to observe if each of these digestions is loaded into a separate well of an agarose gel, and the fragments separated by electrophoresis. In the first well you load a DNA marker (M) containing fragments with sizes of 1000 bp, 2000 bp, 4000 bp and 8000 bp. c) This gel is transferred to a membrane in a Southern blot experiment, and hybridised to a radioactively labelled 200 bp probe, which anneals to the plasmid DNA at the position indicated on the diagram above. Draw the autoradiographic profile you would expect to observe for the membrane.A DNA strand was sequenced using the Sanger method (https://www.youtube.com/watch?v=KTstRrDTmWI). The reaction tube contained the DNA strand, fluorescently labelled dideoxynucleotide triphosphates (ddATP – yellow, ddGTP – green, ddCTP – blue, ddTTP - red), deoxynucleotide triphosphates, DNA polymerase, or its Klenow fragment. Synthesis of DNA is allowed to proceed, and the results are shown on the right: 15 14 13 12 11 10 (a) What is the sequence of the copy and the template strands? (b) If the template strand were in the 5'-3' direction, what will be the sequence of the DNA copy? Nucleotide LengthThis plasmid was digested using different restriction enzymes whose sites have been mapped. The plasmid is 7896 base pairs long. This is a long question so u can count this as two or even three but please answer the question? Determine the size (base pairs) and number of fragments that would be produced if the plasmid was digested with the following enzymes: a) EcoRI b) BamHI c) HindIII d) EcoRI and HindIII e)EcoRI, HindIII, and BamHI *Hint- this is actually an EASY question, since the restriction map is already drawn for you!
- You wish to insert a gene in the plasmid below. (Note the neon green lines represent restriction sites.) amp gene BamHI Sacl Saçl EcoRI BamHI 33 BamHI Gene of interest Chromosomal DNA from human cells a) Which restriction enzyme should you use to cleave the plasmid? Explain your answer. b) How would you create a cDNA library for the chromosomal DNA containing the gene of interest? c) The green area on the plasmid is the ampicillin resistance gene. Explain how you would use it to screen for a recombinant plasmid. 11) Restriction enzymes come in a concentration of U/ml, and it is recommended that 1U be used for each ug of DNA to be digested. If an enzyme you want to use comes in at 22,000 U/ml, and you want to digest 5 ug of DNA. How much volume will you have to use for the reaction and how will you be able to measure it with the pipettes we have in the lab? 2) An enzyme for ligation (Cip) comes at a concentration of 16000 units/ml. How many units will there be in 10 ul?If a 500 bp of DNA between the two restriction sites were deleted, how would the banding pattern on the gel differ from the one you drew in part a? (Part a is attached)