What is the correct answer? tabPLSUCollegeBoardesc!1Pre-APAQuestion 9 DIn a population of cows, there was an outbreak of an unknown disease. Samples from the digestive tracts of the sick cows were analyzed. All of the samples were found to contain the same threepossibly infectious microbes, X, Y, and Z. The table lists selected characteristics of microbes X, Y, and Z.Characteristics of Three Microbes Found In Samples from Sick Cows9Microbe Y only←@Unit 3 Learning Checkpoint 227W10)Has a cell wallHas a membrane surrounding its genetic materialReleases genetic material into hostCan replicate its own genetic materialHas its own ribosomesMoves by flagella or cilia#3eC(12)$4r55%tOllMicrobe XScientists took an extract of each of the three microbes. Using the information in the table, in which of the following icrobes can the process of translatA6YesyNoNoYesYesYes&7Microbe YONoUNoYesNoNoNo*8Microbe ZONoYesNoYesYesYes(9» Q●*O0Mahad Skinner4Р< 9 of 12 >XQ 100%+8?COSubmit(back CollegeBoard Prе-APABCMicrobe Y onlyDMicrobes Yand ZMicrobes X and ZHas its own ribosomesScientists took an extract of each of the three microbes. Using the information in the table, in which of the following microbes can the process of translation occur?Microbe Z onlyMoves by flagella or cilia7Yes6YesNoONoYesYesQ✓

Answered: Image /qna-images/answer/10bd4ff7-2b3f-4438-8eca-69c800c5801e.jpg

A B C Microbe Y only D Microbes Yand Z Microbes X and Z Has its own ribosomes Scientists took an extract of each of the three microbes. Using the information in the table, in which of the following microbes can the process of translation occur? Microbe Z only Moves by flagella or cilia Yes Yes No No Yes Yes

A B C Microbe Y only D Microbes Yand Z Microbes X and Z Has its own ribosomes Scientists took an extract of each of the three microbes. Using the information in the table, in which of the following microbes can the process of translation occur? Microbe Z only Moves by flagella or cilia Yes Yes No No Yes Yes

Microbiology for Surgical Technologists (MindTap Course List)

2nd Edition

ISBN:9781111306663

Author:Margaret Rodriguez, Paul Price

Publisher:Margaret Rodriguez, Paul Price

Chapter2: The Science Of Microbiology

Section: Chapter Questions

Problem 3TBP

See similar textbooks

Similar questions

I need help answering this question to my professor: The topic for the discussion was this one: Some potentially pathogenic bacteria and fungi, including strains of Enterococcus, Staphylococcus, Candida, and Aspergillus, can survive for one to three months on a variety of materials found in hospitals, including scrub suits, lab coats, plastic aprons, and computer keyboards. What can hospital personnel do to reduce the spread of these pathogens? My answer was this one: To reduce the spread of these pathogens an infection control protocol should be followed. Some ways in which this could be reduced is by using desinfectants, sterilization, hand washing, and disposing techniques. In addition, I currently work as a dental assistant at Jackson Main and the protocol we use is hand washing our hands for at least 20 seconds before and after seeing every patient. We use CaviWipes to disinfect every surface and autoclave every single instrument after every use. Also, we make sure to…
Title: "Putting Koch's Postulate to Test" Choose a microbial disease and use Koch's Postulates to prove that it is caused by the implicated microorganism. Specifically, you have to provide brief narratives/pictures/proofs and sources that supports each postulate Make a 1. Page Report.
8 F ~ A References Aav Po AV nited Kingdom) Mailings Review E EVE la WC7137 - Medical Microbiology REP 21-22 View RCM 24 | Figure 1 D Tell me AaBbCcDdEe Normal 3. A 3-year-old child was brought to the emergency by her parents because of fever and difficulty in rousing her for the past 24 hours. Meningitis is suspected. An image from the Gram staining of the CSF sample is shown in Figure 1. The child was started on IV antibiotics and the fever subsides on Day 1 post-admission. However, fever recurred on the third day post admission. An intravenous catheter associated blood stream infection was suspected and blood cultures were taken. After 24 hours, the blood culture shows the growth of a Gram-positive bacteria. The picture of the culture growth on blood agar is shown in Figure 2. Based on this information, answer the following questions. AaBbCcDdEe No Spacing MacBook Air Aa BbCcDc AaBb CcDdE AaBb Aa Bb Heading 1 Heading 2 Title Su 2. Figure 2 c) Discuss the host-pathogen interactions…
Help me, please! I wish I have a lot of time to do it by myself ... This is the article link and a microbiology open Stax book link for chapter 16 terms. Please help me to find answers. https://piercemil.instructure.com/courses/2180982/assignments/24927088 https://openstax.org/books/microbiology/pages/15-2-how-pathogens-cause-disease#OSC_Microbio_15_02_Invasion Questions: If possible please write the pg of an article with related Answers; it will be easier for me to describe in detail. Thank You for Helping me. Using the terms found in the “Patterns of Incidence” subsection in Chapter 16, what pattern of incidence best matches the outbreak described in the article? Using the terms found in the “Pioneers of Epidemiology” subsection in Chapter 16, which discusses “spread”, what type of spread of the pathogen best matches the outbreak described in the article? Be specific. What type of epidemiological study was used to identify the source of the pathogen in the article? Be specific.…
Microbes in our Lives 1. List several ways in which microbes affect our lives. Naming and Classifying Microorganisms 1. Recognize the system of scientific nomenclature that uses two names: a genus and a specific epithet. 2. Differentiate the major characteristics of each group of microorganisms. 3. List the three domains. A Brief History of Microbiology 1. List at least four beneficial activities of microorganisms. 2. Name two examples of biotechnology that use recombinant DNA technology and two examples that do not. 3. Explain the importance of observations made by Hooke and van Leeuwenhoek. 4. Compare spontaneous generation and biogenesis. 5. Identify the contributions to microbiology made by Needham, Spallanzani, Virchow, and Pasteur. 6. Define bacteriology, mycology, parasitology, immunology, and virology. 7. Explain the importance of microbial genetics and molecular biology.
This is a figure from a recent paper comparing different bacterial pathogen strains. What is being compared in this figure? 810 820 830 ATCAAACAGGATTAGATACCCTGGTAGTCCACGC ATCAAACAGGATTAGATACCCT GGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACC AGCAAACAGGATTAGATACCCTGGTAGTCCACC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC ATCAAACAGGATTAGATACCCTGGTAGTCCACAC Staphylococcus aureus Staphylococcus epidermidis Enterococcus faecalis Streptococcus pneumoniae Escherichia coli Enterobacter cloacae Klebsiella pneumoniae Pseudomonas aeruginosa Haemophilus influenzae Bacteroides fragilis Polypeptides Proteins DNA RNA Amino acids
The first step for directly linking a microbe to a specific disease according to Koch's postulates is to O isolate microbes from the blood of healthy animals. obtain a sample of blood or other body fluid from a diseased animal. O culture the blood or other body fluid from a discased animal using nutrient medium. O inject a sample of blood or other body fluid from a diseased animal into a healthy animal. O compare the blood of a sick animal to blood obtained from a healthy animal.
Day Care Center outbreak: Salmonellosis You just finished identifying the fecal contaminated food at the first restaurant when you learn there is an outbreak of Salmonella-food poisoning at a day care center, You sample food from the Center's refrigerator and are worried that the egg salad or chicken salad or peanut butter used to make sandwiches may be contaminated with Salmonella. You know Salmonella cannot ferment lactose and it can make hydrgoen sulfide. The strain associated with the outbreak cannot ferment sucrose but can ferment glucose. You isolate in pure culture bacteria from each of the suspect foods and inoculate each into TSI slants. (see results below) egg salad microbe chicken salad microbe peanut butter microbe TSI TSI TSI W FWS
ITEM MSM MICROBIAL PROFILE I MICROORGANISM/CAUS ATIVE AGENT A GRAM REACTION B OXYGEN REQUIREMENT с SIZE SHAPE HABITAT DISCOVERY G MICROSCOPIC IMAGE || | DISEASE PROFILE DISEASE/S A B SYMPTOMS OF THE DISEASE C INCUBATION PERIOD D MODE OF TRANSMISSION DIAGNOSIS TREATMENT PREVENTION NO OF DAYS BEING SYMPTOMATIC I IMAGE OF INFECTED PATIENT DEFG EFGH G PROFILE Haemophilus ducreyi
Part A. 1.Why do microbiologists use cultured plates with 30 to 300 colonies used for calculations? 2. Why is ground beef a better bacterial growth medium than a steak or roast. 3. Why does repeated freezing and thawing increase bacterial growth if meat is then left at room temperature?
The world is facing a Corona Virus (COVID-19) Pandemic and as a potential scientist and a microbiology student, you have been required to prepare the easiest and most affordable hand sanitizer that can be utilized by students in various microbiology laboratories. Each student in your class has been given 96% ethanol and you are required to prepare 70% ethanol hand sanitizer in a 2L spray bottle. Describe clearly the method you will use in order to achieve the aim of the practical.
Medically Significant Bacteria: Causative Agent and Disease Profile ITEM IMPORTANCE OF BACTERIA PROFILE BACTERIAL PROFILE I MICROORGANISM/CAUSATIVE AGENT A GRAM REACTION B OXYGEN REQUIREMENT C SIZE D SHAPE E HABITAT F DISCOVERY G MICROSCOPIC IMAGE II DISEASE PROFILE A DISEASE/S B SYMPTOMS OF THE DISEASE C INCUBATION PERIOD D MODE OF TRANSMISSION E DIAGNOSIS F TREATMENT G PREVENTION H NO OF DAYS BEING SYMPTOMATIC I IMAGE OF INFECTED PATIENT GENERAL INSTRUCTIONS: Using the template provided above, fill out the information for a bacteria. YOU CAN CHOOSE ANY BACTERIA from 1-60 BELOW: List of medically significant bacteria Aerobic Gram (+) Cocci S. epidermidis S. saprophyticus Streptococcus pyogenes Streptococcus agalactiae Enterococcus(E. faecalis, E.…