Foundations in Microbiology
10th Edition
ISBN: 9781259705212
Author: Kathleen Park Talaro, Barry Chess Instructor
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Textbook Question
Chapter 8.2, Problem 12CYP
12. What is meant by the concept of the “final electron acceptor�?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
. The following diagram shows the biosynthesis of B12 coenzymes,
starting with the vitamin. DMB is dimethylbenzimidazole.
(a) What one additional substrate or cofactor is required by enzyme B?
(b) Genetic deficiency in animals of enzyme C would result in exces-
sive urinary excretion of what compound?
10. Chymotrypsin is a serine protease enzyme. The Km for the reaction of chymotrypsin with
N-acetylvaline ethyl ester is 8.8*102, and the Km for the reaction of chymotrypsin with N-
acetyltyrosine ethyl ester is 6.6*10“ M.
catalytic
triad
Ser 195
His 57
Gly 193
N-H
OH
R-N- Ca
N-H
O-C- Asp 102
N-acetyl valine
N-acetyl tyrosine
Chymotrypsin Active Site
a. What is the nucleophile here and how is it activated?
b. Which substrate has an apparent higher affinity for the enzyme.
c. Propose a reason for the difference in affinity based on the shape of each of the
substrates (see active site figure, cleaves on the C-side of aromatic residues).
16.
The overall reaction for the glycolysis reaction is
C6H₁2O6(aq) + 2NAD+ (aq) + 2ADP³(aq) + 2HPO(aq) + 2H₂O(1)
2CH3COCO₂ (aq) + 2NADH(aq) + 2ATP4 (aq) + 2H3O+ (aq).
What is A,G at chemical equilibrium?
Chapter 8 Solutions
Foundations in Microbiology
Ch. 8.1 - 1. Define metabolism and differentiate its two...Ch. 8.1 - Prob. 2ELOCh. 8.1 - 3. outline the prominent characteristics of...Ch. 8.1 - 4. Explain how enzymes lower the energy required...Ch. 8.1 - 5. Discuss enzyme structure, and interactions...Ch. 8.1 - 6. Describe the types of enzyme functions and...Ch. 8.1 - 7. Summarize key features of enzyme regulation.Ch. 8.1 - 1. Differentiate between catabolism and anabolism...Ch. 8.1 - 2. Describe 10 important biochemical properties of...Ch. 8.1 - 3. Describe the chemistry of enzymes, and explain...
Ch. 8.1 - 4. Show diagrammatically the interaction of...Ch. 8.1 - 5. Differentiate among the chemical composition...Ch. 8.1 - 6. Summarize the direct and indirect controls that...Ch. 8.2 - Prob. 8ELOCh. 8.2 - 9. Describe biological oxidation-reduction and...Ch. 8.2 - Prob. 10ELOCh. 8.2 - 7. Explain how oxidation of a substrate proceeds...Ch. 8.2 - 8. Refer to the blue redox equation for...Ch. 8.2 - 9. In the following redox pairs, which compound is...Ch. 8.2 - 10. a. Describe the roles played by ATP and NAD+...Ch. 8.2 - Prob. 11CYPCh. 8.2 - 12. What is meant by the concept of the “final...Ch. 8.3 - 11. Relate the main points of bioenergetics and...Ch. 8.3 - 12. Describe the main catabolic pathways and their...Ch. 8.3 - 13. Define glycolysis and explain its input and...Ch. 8.3 - Prob. 14ELOCh. 8.3 - 15. Describe the components of the respiratory...Ch. 8.3 - 16. Explain the chemiosmotic mechanism of ATP...Ch. 8.3 - 17. Summarize the results of aerobic respiration.Ch. 8.3 - Prob. 18ELOCh. 8.3 - 13. Describe the basic energy strategies of...Ch. 8.3 - Prob. 14CYPCh. 8.3 - 15. Outline the basic steps in glycolysis,...Ch. 8.3 - Prob. 16CYPCh. 8.3 - 17. What is the fate of NADH in a fermentative...Ch. 8.3 - 18. Summarize the chemiosmotic theory of ATP...Ch. 8.3 - 19. Haw many ATPs could theoretically be formed...Ch. 8.3 - Prob. 20CYPCh. 8.3 - 21. Name the sources of oxygen in bacteria that...Ch. 8.3 - 22. What are the final electron acceptors in...Ch. 8.3 - Prob. 23CYPCh. 8.4 - 19. Explain what is meant by the term fermentation...Ch. 8.4 - 20. Describe some of the processes of fermentation...Ch. 8.4 - 24. What adaptive advantages does a fermentative...Ch. 8.4 - 25. Describe three patterns of fermentation...Ch. 8.5 - 21. Explain how cells perform anabolic functions...Ch. 8.5 - 22. Identify major pathways where molecules can be...Ch. 8.5 - 23. Briefly describe several mechanisms in...Ch. 8.5 - 26. What is meant by amphibolism, and what are its...Ch. 8.5 - Prob. 27CYPCh. 8.5 - 28. Which macromolecules are synthesized by...Ch. 8.6 - 24. Outline the general reactions of...Ch. 8.6 - 25. Describe the pigment systems and how they...Ch. 8.6 - 26. Describe the main events in the...Ch. 8.6 - 27. Describe the main events in the...Ch. 8.6 - 29. Indicate whether each of the following is...Ch. 8.6 - Prob. 30CYPCh. 8.6 - 31. What are the functions of chlorophyll and the...Ch. 8.6 - Prob. 32CYPCh. 8.6 - 33. Compare oxygenic with nonoxygenic...Ch. 8.L1 - 1. ______ is another term for biosynthesis. a....Ch. 8.L1 - Prob. 2MCQCh. 8.L1 - 3. An enzyme ___________ the activation energy...Ch. 8.L1 - 4. An enzyme a. becomes part of the final products...Ch. 8.L1 - 5. An apoenzyme is where the ___________ is...Ch. 8.L1 - 6. Many coenzymes contain a. metals b. vitamins c....Ch. 8.L1 - 7. To digest cellulose in its environment, a...Ch. 8.L1 - 8. Energy in biological systems is primarily a....Ch. 8.L1 - 9. Energy is carried from catabolic to anabolic...Ch. 8.L1 - 10. Exergonic reactions a. release potential...Ch. 8.L1 - Prob. 11MCQCh. 8.L1 - Prob. 12MCQCh. 8.L1 - Prob. 13MCQCh. 8.L1 - 14. Fermentation of a glucose molecule has the...Ch. 8.L1 - Prob. 15MCQCh. 8.L1 - Prob. 16MCQCh. 8.L1 - 17. The FADH2 formed during the Krebs cycle enters...Ch. 8.L1 - 18. The proton motive force is the result of a....Ch. 8.L1 - Prob. 19MCQCh. 8.L1 - Prob. 20MCQCh. 8.L1 - 21. The oxygen produced by photosynthesis comes...Ch. 8.L1 - Prob. 22MCQCh. 8.L1 - Prob. 1CSRCh. 8.L1 - Prob. 2CSRCh. 8.L1 - Prob. 3CSRCh. 8.L1 - Prob. 1WCCh. 8.L1 - 2. Give the general name of the enzyme a. converts...Ch. 8.L1 - 3. Explain what is unique about the actions of ATP...Ch. 8.L1 - Prob. 4WCCh. 8.L1 - 5. Describe four requirements required for...Ch. 8.L1 - Prob. 6WCCh. 8.L1 - Prob. 7WCCh. 8.L1 - Prob. 8WCCh. 8.L2 - 1. Use the following graph to diagram the...Ch. 8.L2 - 2. Explain what is meant by the “biochemical...Ch. 8.L2 - 3. Explain how it is possible for certain microbes...Ch. 8.L2 - 4. Suggest the advantages of having metabolic...Ch. 8.L2 - 5. Two steps in glycolysis are catalyzed by...Ch. 8.L2 - 6. Beer production requires an early period of...Ch. 8.L2 - 7. What would be the expected pHs of the matrix...Ch. 8.L2 - 8. At which site in the mitochondrion and...Ch. 8.L2 - Prob. 9CTCh. 8.L2 - Prob. 10CTCh. 8.L2 - 1. From chapter 7. figure 7.11 (reproduced below)....Ch. 8.L2 - 2. Look at the two figure parts (a) and (b) from...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- 4. a) Structures A, B and C are derivatives of penicillin Н NHH +x A i) ii) iii) CO₂H HH Ex B CO₂H R Describe briefly how the activity of B and C compares with A. b) The biosynthesis of penicillin involves two amino acids с Name the two amino acids. What is the name of the enzyme inhibited by the penicillin? What does penicillin mimic in bacteria cell wall synthesis?arrow_forward6-One method to determine proximity of two locations in a protein molecule or protein complex is FRET. This technique uses fluorescence transfer between two fluorophores where the ability of the transfer to occur is correlated to distance between the two residues. A) On the following graph using colored pencils, pens, or markers draw the emission spectra from the donor and the absorbance spectra of the acceptor (this should be a general schematic, does not need to be a FRET pair). Include a key for your graph B) As a rescarch student in my group you want to study the proximity of two residues in clamp region of a protein. Draw a schematic of your protein and label the two locations of your fluorophores. In 2-4 sentences (or figures) explain how your FRET fluorophores would give determine if these two residues were close to one another.arrow_forward2. The diagram to the right shows the change in the structure of the C-terminal portion of each of the ẞ-subu- nits of human hemoglobin (HbA) in the oxyHb to deox- yHb or R-to-T transition. The hydrogen bonding interac- tion of the C-terminal ẞHis 146 residue with the side chain of Asp94, highlighted by the red ellipse, has been shown to be responsible for a major portion of the proton uptake associated with the Bohr effect. Treatment of HbA with the enzyme carboxypeptidase A (CPA) results in loss of the C-terminal ẞHis 146 and ẞTyr145 residues of the ẞ- subunits. (a) ( ) Draw a Hill plot [log(Y/[1-Y]) vs. log(pO2), Y = fraction of heme groups occupied by O2] to compare the values of the Hill coefficient nн and the O2-binding affinity at pH 7.4 of normal HbA before and after treat- ment of with CPA. (b) (' ) How will the plot for CPA-digested HbA change at pH 7.2? (c) 1 Hi5146 HN- ✓ Low PK B-chain. CH2 CH-NH-CO-CH-NH- CH₂ Tyr145 он HbO2 or R state Туг145 CH-CH2- OH co NH CH CH₂ His…arrow_forward
- 3. Solve the sequence of an oligopeptide 7 residues long which gave: Asp Leu Lys Met Phe Tyr The following facts were observed: a. Trypsin treatment had no apparent effect b. The PTH derivative from Edman degradation was c. Brief chymotrypsin treatment yielded several products including but not limited to a dipeptide and a tetrapeptide. The amino acid composition of the tetrapeptide was Leu, Lys, and Met. d. Cyanogen bromide treatment yielded a dipeptide, a tetrapeptide, and a free Lys. Instructions Make use of the table below to determine the sequence of the mystery protein.arrow_forwardThe amln0 acid histldine ls usually found in actlve sltes 0f enzymes. What structural feature does the R group of hlstidine have that may be important for the activity of enzymes? Explainarrow_forward3. Solve the sequence of an oligopeptide 7 residues long which gave: Asp Leu Lys Met Phe Tyr The following facts were observed: a. Trypsin treatment had no apparent effect b. The PTH derivative from Edman degradation was c. Brief chymotrypsin treatment yielded several products including but not limited to a dipeptide and a tetrapeptide. The amino acid composition of the tetrapeptide was Leu, Lys, and Met. d. Cyanogen bromide treatment yielded a dipeptide, a tetrapeptide, and a free Lys.arrow_forward
- (a) Draw diagrams to show how the four synthetic oligonucleotides below could base-pair to form a stable model Holliday junction. W 5' GATCGCATTGTAGCCGTAGGTCCACTGTAA 3’ X 5' GTCCCATACGTAGCCGTAGGACATGTACCG 3' Y 5' CGGTACATGTCCTACGGCTACAATGCGATC 3' Z 5' TTACAGTGGACCTACGGCTACGTATGGGAC 3' I and 21arrow_forwardо 6. What is the catalytic triad and what particular protein family would you find this? What is the general role of the catalytic triad? Predict what would happen if Asp were mutated to Gly. ructure formation of alpha heliarrow_forwardWhich of the following is an anomer of a-D-galactopyranose? CH,OH он он он H он ÇH,OH OH он H он H он ÇH,OH он H. H OH он ÇH,OH OH он он он HHIarrow_forward
- 2. Amino acid analysis of the a heptapeptide gave the following residues: Asp Glu Leu Lys Met Tyr Trp NH4+. The following facts were observed: Trypsin treatment had no effect. The phenylthiohydantoin released by Edman degradation was OH H C-C-CH₂ H. Brief chymotrypsin treatment yielded several products including a dipeptide and a tetrapeptide. The tetrapeptide contained Glu, Leu, Lys and Met is some order. Cyanogen bromide treatment afforded a tetrapeptide that had a net positive charge at pH 7 and tripeptide that had a zero net charge at pH 7. What is the amino acid sequence for this heptapeptide?arrow_forward9. The T conformation of the hemoglobin tetramer is stabilized (in part) by a salt linkage between the side chain of the lysine residue at position 40 in the a-chain of one aß dimer and the C-terminal carboxylate group of the ß-chain of the opposing aß dimer. Draw a diagram of this salt linkage (show complete side chains).arrow_forward19. Which statement is TRUE of sphingolipid synthesis? 1.All of the carbon atoms of palmitate and serine are incorporated into sphingosine. 2CDP-sphingosine is the activated intermediate. 3CO2 is produced during the synthesis of ceramide from palmitate and serine. 4Glucose 6-phosphate is the direct precursor of the glucose in cerebrosides. 5Phosphatidic acid is a key intermediate in the pathway.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
GCSE Chemistry - Acids and Bases #34; Author: Cognito;https://www.youtube.com/watch?v=vt8fB3MFzLk;License: Standard youtube license