a.
To determine: The primary eight amino acids for each of the given DNA sequences, which are given as follows:
Introduction: The given DNA sequences encode the initial eight amino acids for five alleles of the Adh protein in Drosophila pseudoobscura. Nucleotides that vary from the first sequence are shown by a lowercase letter. The sequences of DNA code for a number of alleles. The alleles are responsible for specific assignation of characters to the individual. There are a number of alleles that can be present within a gene. The genes are present in the chromosomes, and the chromosomes are present in pairs. Alleles are responsible for the genotypic character of the organism, which reflects in the
a.
Explanation of Solution
The given DNA sequences are as follows:
The amino acids from the above DNA sequences using the codon table are given below:
b.
To determine: The five polymorphic sites and signify whether the site is represented by synonymous or non-synonymous polymorphisms in the given DNA sequences.
Introduction: The given DNA sequences encode the initial eight amino acids for five alleles of the Adh protein in Drosophila pseudoobscura. Nucleotides that vary from the first sequence are shown by a lowercase letter. The sequences of DNA code for a number of alleles. The alleles are responsible for specific assignation of characters to the individual. There are a number of alleles that can be present within a gene. The genes are present in the chromosomes, and the chromosomes are present in pairs. Alleles are responsible for the genotypic character of the organism, which reflects in the phenotype of the organism.
b.
Explanation of Solution
The process of polymorphism results in the modification of the
The synonymous or non-synonymous polymorphisms in sequences are as follows:
The production of “alanine” in the second sequence fulfills the criteria of polymorphism.
c.
To determine: The one-difference intermediate in the production of TTG from CTC.
Introduction: The given DNA sequences encode the initial eight amino acids for five alleles of the Adh protein in Drosophila pseudoobscura. Nucleotides that vary from the first sequence are shown by a lowercase letter. The sequences of DNA code for a number of alleles. The alleles are responsible for specific assignation of characters to the individual. There are a number of alleles that can be present within a gene. The genes are present in the chromosomes, and the chromosomes are present in pairs. Alleles are responsible for the genotypic character of the organism, which reflects in the phenotype of the organism.
c.
Explanation of Solution
According to the provided information, the CTC sequence is responsible for the production of TTG sequence. Both the codons code for “Leu.” However, the codon that could be the intermediate of the process could be the same as “leu.” TTC codes for the “Phe” when activated; hence, it cannot be the intermediate in the reaction. Hence, the one-difference intermediate must be CTG, which also codes for the “Leu” that forms the bridge in the production of TTG from the CTC codon.
d.
To determine: The reason that synonymous polymorphisms are likely to be more frequent than non-synonymous polymorphisms.
Introduction: The given DNA sequences encode the initial eight amino acids for five alleles of the Adh protein in Drosophila pseudoobscura. Nucleotides that vary from the first sequence are shown by a lowercase letter. The sequences of DNA code for a number of alleles. The alleles are responsible for specific assignation of characters to the individual. There are a number of alleles that can be present within a gene. The genes are present in the chromosomes, and the chromosomes are present in pairs. Alleles are responsible for the genotypic character of the organism, which reflects in the phenotype of the organism.
d.
Explanation of Solution
There is a repetition of “3-letter codes” along the codon for the coding of specific amino acid. The production of new amino acid takes place when there is a change in the second element, resulting in non-synonymous polymorphism. However, changes in the third element of the codon give the similar amino acid. Thus, synonymous polymorphisms are likely to be more frequent than non-synonymous polymorphisms.
Want to see more full solutions like this?
Chapter 4 Solutions
Evolution
- The bacterial gene shorty (sh) encodes for a small protein. The DNA sequence of the sh gene is shown below. The ORF is in CAPITAL LETTERS 5’-tataatgggcttaacaATGAGTAAAAGAGGTCCTTTACTCCGGTATCACCAATAGaaatattatttaa-3’ 3’-atattacccgaattgtTACTCATTTTCTCCAGGAAATGAGGCCATAGTGGTTATCtttataataaatt What is the length in AA’s of the Sh protein? Assume fMet is NOT CLEAVED [10%] 39 AA 13 AA 12 AA 21 AAarrow_forwardhe Sequence below comes from the alpha-2 globin of the human hemoglobin gene cluster found in chromosome 16. The globin region of the hemoglobin protein itself consists of 2 alpha chains and 2 beta chains. 1 actcttctgg tccccacaga ctcagagaga acccaccatg gtgctgtctc ctgccgacaa 61 gaccaacgtc aaggccgcct ggggtaaggt cggcgcgcac gctggcgagt atggtgcgga 121 ggccctggag aggatgttcc tgtccttccc caccaccaag acctacttcc cgcacttcga 181 cctgagccac ggctctgccc aggttaaggg ccacggcaag aaggtggccg acgcgctgac 241 caacgccgtg gcgcacgtgg acgacatgcc caacgcgctg tccgccctga gcgacctgca 301 cgcgcacaag cttcgggtgg acccggtcaa cttcaagctc ctaagccact gcctgctggt 361 gaccctggcc gcccacctcc ccgccgagtt cacccctgcg gtgcacgcct ccctggacaa 421 gttcctggct tctgtgagca ccgtgctgac ctccaaatac cgttaagctg gagcctcggt 481 agccgttcct cctgcccgct gggcctccca acgggccctc ctcccctcct tgcaccggcc 541 cttcctggtc…arrow_forward5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. Write the resulting amino acid sequence using the 3 letter code. Write the answer in a all capital letters. Leave a space between the amino acids. Do not write 5' and 3'. 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. If the G in Bold changes to a T, then the result will be A) A nonsense mutation B) A frameshift mutation C) A silent substitution D) A missense mutation 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. If the G in Bold changes to a A, then the result will be A) A nonsenese mutation B) A frameshift mutation C) A silent substitution D) A missense mutationarrow_forward
- Sequence: CCACCTGTACCCGGACACACCCTGGTGTCC Are there homologues for the identified gene in other systems? Identify one homologue in a invertebrate system (if there is none, provide a vertebrate homologue). What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease etc.) of the protein(s) encoded by the gene.arrow_forwardThis is the pre-mRNA of a mammalian gene with the spice sites marked. 5’-AGCUUCGCGUAAAUCGUAG/GUAAGUUGUAAUAAAUAUAAGUGAGUAUGAUAG\GGCUUUGG ACCGAUAGAUGCGACCCUGGAG/GUAAGUAUAGAUAAUUAAGCACAG\GCAUGCAGGGAUAUCCU CCAAAUAG/GUAAGUAACCUUACGGUCAAUUAAUUAG\GCAGUAGAUGAAUAAACGAUAU CGAUCGGUUAG/GUAAGUCUGAU-3’ This is the spliced mRNA with the spliced sites marked with a vertical line, “|”. 5’-AGCUUCGCGUAAAUCGUAG|GGCUUUGGACCGAUAGAUGCGACCCUGGAG|GCAUGCAGGGAUAUCCU CCAAAUAG|GCAGUAGAUGAAUAAACGAUAUCGAUCGGUUAGGUAAGUCUGAU-3’ Translate this mammalian mRNA into the correct amino acid sequence. In your answer, use the three letter abbreviations for each amino acid.arrow_forwardIf we have the following mutations, find the type of the mutation (silent or missense or nonsense?) 17C=U 36G=A 49G=U 115A=C 5’ AAACUGUGACUGAACCUCAAACCCCAAACCAGCCCGAGGAGAACCACAUUCUCCCAGGGA CCCAGGGCGGGCCGUGACCCCUGCGGCGGAGAAGCCUUGGAUAUUUCCACUUCAGAAGCC UACUGGGGAAGGCUGAGGGGUCCCAGCUCCCCACGCUGGCUGCUGUGCAGAUGCUGGACG ACAGAGCCAGGAGGGAGGCCGCCAAGAAGGAGAAGGUAGAGCAGAUCCUGGCAGAGUUCCAGC UGCAGGAGGAGGACCUGAAGAAGGUGAUGAGACGGAUGCAGAAGGAGAUGGACCGCGGCCUGA GGUAGAAGCCGCUGGGGCUUGGGGCU-3’arrow_forward
- Dystrophin is a protein that forms part of a vital protein complex that connects the cytoskeleton of a muscle fiber cell to the extracellular matrix. This connection strengthens and shapes the muscle fibers. Dystrophin is coded by the DMD gene. This is one of the longest human genes known, covering 2,300,000 base pairs (0.08% of the human genome) It is located in chromosome 21. The immature mRNA is 2,100,000 bases long and takes 16 hours to transcribe. It contains 79 exons. The mature mRNA measures 14,000 and codes for a protein with 3,685 amino acids. Abnormal expression of dystrophin leads to severe symptoms like muscle weakness and fatigability, a disease that is called muscular dystrophy. Most patients with muscular dystrophy become wheelchair dependent early in life. Cardiac muscle is also affected which results typically in premature death (~ second or third decade of life). Several mutations in this gene have led to the production of low levels of dystrophin or of a defective,…arrow_forwardThe first thing you'll need to do is annotate the DCR1 gene, as follows: 1 agagtctcct cagacgccga gatgctggtc atggcgcccc gaaccgtcct cctgctgctc 61 tcggcggccc tggccctgac cgagacctgg gccggtgagt gcgggtcggg agggaaatgg 121 cctctgccgg gaggagcgag gggaccqсag gс¶¶¶¶gcgc atgacctcag gagccgcgcc 181 gggaggaggg tcgggcgggt ctcagcccct cctcaccccc aggctcccac tccatgtggt 241 atttctacac ctccgtgtcc cggcccqgcc gcggggagcc ccgcttcatc tcagtgggct 301 acgtggacga cacccagttc gtgaggttcg acagcgacgc cgcgagtccg agagaggagc 361 cgcgggcgcc gtggatagag caggaggggc cggagtattg ggaccggaac acacagatct 421 acaaggccca ggcacagact gaccgagaga gcctgcggaa cctgcgcttc tactacaacc 481 agagcgaggc cgttgcqtga ccccqgcccg gggcgcaggt cacgactccc catcccccac 541 gtacqgcccg ggtcgccccg agtctccggg tccgagatcc gcctccctga ggccqcggga promoter: nucleotide 1 - 108; highlight in yellow exon #1: nucleotide 109 - 285; highlight in green intron (there is only one intron in this gene); highlight in light grey exon #2: nucleotide 455 - 567; highlight in blue start…arrow_forwardThe human PAH gene encodes the enzyme phenylalanine hydroxylase. Deficiency of this enzyme activity results in the autosomal recessive disorder phenylketonuria. The first 9 amino acids of the wild-type human PAH protein are: MSTAVLENP The sequence below shows the first 9 codons of a mutant allele of the human PAH gene: atg tcc act agc ggt cct gga aaa ccc What type of mutation has occurred in the coding sequence? Group of answer choices silent frameshift nonsense missensearrow_forward
- In the human genome for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotide in the amino acid coding region is represented by the sequence 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5'arrow_forwardFor the following sequence design the forward and reverse primer... explain and justify your answer. Full sequence would be: 1 tctagagtca tgaaacaaca aaaacggctt tacgcccgat tgctgacgct gttatttgcg 61 ctcatcttct tgctgcctca ttctgcagca gcggcggcaa atcttaatgg gacgctgatg 121 cagtattttg aatggtacat gcccaatgac ggccaacatt ggaagcgttt gcaaaacgac 181 tcggcatatt tggctgaaca cggtattact gccgtctgga ttcccccggc atataaggga 241 acgagccaag cggatgtggg ctacggtgct tacgaccttt atgatttagg ggagtttcat 301 caaaaaggga cggttcggac aaagtacggc acaaaaggag agctgcaatc tgcgatcaaa 361 agtcttcatt cccgcgacat taacgtttac ggggatgtgg tcatcaacca caaaggcggc 421 gctgatgcga ccgaagatgt aaccgcggtt gaagtcgatc ccgctgaccg caaccgcgta 481 atttcaggag aacacctaat taaagcctgg acacattttc attttccggg gcgcggcagc 541 acatacagcg attttaaatg gcattggtac cattttgacg gaaccgattg ggacgagtcc 601 cgaaagctga accgcatcta taagtttcaa ggaaaggctt gggattggga agtttccaat 661 gaaaacggca actatgatta tttgatgtat gccgacatcg attatgacca tcctgatgtc 721 gcagcagaaa ttaagagatg gggcacttgg…arrow_forwardFor the following sequence design the forward and reverse primer... explain and justify your answer. Gene of Interest: a tgaaacaaca aaaacggctt tacgcccgat tgctgacgct gttatttgcg 61 ctcatcttct tgctgcctca ttctgcagca gcggcggcaa atcttaatgg gacgctgatg 121 cagtattttg aatggtacat gcccaatgac ggccaacatt ggaagcgttt gcaaaacgac 181 tcggcatatt tggctgaaca cggtattact gccgtctgga ttcccccggc atataaggga 241 acgagccaag cggatgtggg ctacggtgct tacgaccttt atgatttagg ggagtttcat 301 caaaaaggga cggttcggac aaagtacggc acaaaaggag agctgcaatc tgcgatcaaa 361 agtcttcatt cccgcgacat taacgtttac ggggatgtgg tcatcaacca caaaggcggc 421 gctgatgcga ccgaagatgt aaccgcggtt gaagtcgatc ccgctgaccg caaccgcgta 481 atttcaggag aacacctaat taaagcctgg acacattttc attttccggg gcgcggcagc 541 acatacagcg attttaaatg gcattggtac cattttgacg gaaccgattg ggacgagtcc 601 cgaaagctga accgcatcta taagtttcaa ggaaaggctt gggattggga agtttccaat 661 gaaaacggca actatgatta tttgatgtat gccgacatcg attatgacca tcctgatgtc 721 gcagcagaaa ttaagagatg gggcacttgg tatgccaatg…arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education