You are trying to annotate a new phage genome; which program or programs should you use to determine each of the following?
Q: Given the following pKa data for the individual amino acids, estimate the pI for the tripeptide…
A: In the given data pKa of amino acids Thr-Asp-Arg is: Thr-? Asp-3.86 Arg-12.48 N-terminal group-…
Q: What functions would you expect to be served by residues such as (a) phenylalanine at the protein…
A: phenylalanine and aspartic acid are two of 20 amino acids involved in peptide bond formation in…
Q: Which of the following monosaccharaides is a Hexose? Dihydroxyacetone phosphate (DHAP) Erythrose…
A:
Q: Interpret the two chromatograms below. Which of the two chromatograms will provide good sequencing…
A: In Automated DNA sequencing, using a laser the different fluorescent labelled nucleotides at the end…
Q: Explain the difference between aldoses and ketoses including its configuration of D and L
A: Carbohydrates, proteins, and lipids are macronutrients that supply the body with energy and basic…
Q: Which of the following is a carbohydrate?
A: Carbohydrates are one of the most important component of diet, it is major energy source for…
Q: Multiple Choice - Explain your answer in 3-5 sentences. - answer properly QUESTION: The allosteric…
A: Proteins that behave as physiological catalysts are known as enzymes. Catalysts speed up the…
Q: ACTIVITY 6.1 Complete the table below Source Example of Carbohydrate Function
A: Carbohydrates are a form of macronutrient that can be found in a variety of foods and drinks.…
Q: 1. A 185g plant based burger is composed 55% carbohydrates, 35% protein and 20% fat. Calculate the…
A: Total energy of a food is expressed in calories. A calorie is a unit of how much energy is in a…
Q: In your own words how are drugs and toxins can have direct and indirect stimulation of the motor…
A: Toxins and drugs are a conceivable and prevalent significant public health problem, but they…
Q: Which of the following is true of ribosome rescue? (C & E wrong) A. The process produces a protein…
A: Ribosomes are present in prokaryotes as well as eukaryotes. mammalian…
Q: Which statements are associated with positively cooperative oxygen binding of a protein? A. The…
A: Haemoglobin is a tetrameric protein. It is a heterotetramer consisting of two alpha subunits and two…
Q: For an enzymatic reaction, the following data were obtained for two different initial enzyme…
A: Enzymes are protein molecules that increase the rate of reactions by decreasing the activation…
Q: A) For this DNA fragment "TGAATTCCCGGGTTCCGGGAATTCGCGCGAATTCCCGGTATA", what is its complementary…
A: Deoxyribonucleic acid (DNA) is a nucleic acid that carries genetic information from parent to…
Q: Name and describe the four weak chemical interaction that occurs in biomolecules.
A: Biomolecules are the essential organic molecules, which are involved in the maintenance and…
Q: Which of the following is the complementary strand of a DNA strand made up of 32% cytosine? A.…
A: Two strands of DNA are complementary to each other , if we know the sequence of one strand, we could…
Q: 2. Use your knowledge of amino acids (and the R groups) and tertiary structures of proteins to…
A: Sickle cell anemia is a inherited disorders due to defect in the gene. In this disease mutation…
Q: If a cell sample is placed in pure water, what is the concentration of the salt inside the cell?…
A: The water move inside the cell and outside the cell through the process of osmosis. If a cell is put…
Q: Do "Enzymatic Browning reaction is intensified with the presence of oxygen?.
A: Introduction Enzymatic browning is a chemical process that we can see in fruits, vegetables etc. .…
Q: Why marathon runners eat a meal rich in carbohydrates the day before the race
A: Nutrients are molecules that aids in the growth and development of living organisms. Nutrients are…
Q: An unknown amino acid labeled BAYOKEM has an IpH value equal to 5.97. 1. If its pka2 is equal to…
A: pH is the measure of the strength of H+ ion or Hydronium ions in solution. pOH is the…
Q: 6. H₂C HO Which of the following dinucleotides can be methylated by DNA methyltransferase? NH₂ NH₂ 9…
A: Since you have asked multiple questions, we will answer only first question for you. In order to get…
Q: 2. Draw out a labeled diagram explaining all the following processes: Gel Filtration Chromatography…
A: Gel Filtration Chromatography: Gel Filtration chromatography is method in which molecules in a…
Q: write the structure of the following nucleotides: 1. 5'-dGMP 2. 5'-dGDP 3. 5'-dGTP 4. 5'-GTP 5.…
A: The nucleotides are the phosphoric acid esters of nucleosides with the phosphate at the C-5'…
Q: for GABA transaminase, ornithine decarboxylase, and alanine
A: PLP-dependent enzymes catalyse a wide range of reactions that result in bond cleavage at the carbons…
Q: Draw the Haworth Projection or the cyclic structure of the following:
A: organic compound organized in the form of aldehydes or ketones with multiple hydroxyl groups coming…
Q: Identify the reactants, enzymes, cofactors/coenzymes and products involved in the glycolysis…
A: Glycolysis is the metabolic pathway that converts glucose to pyruvate in a series of enzymatic…
Q: Which of the following steps does NOT require ATP? O A. Conversion of glucose to glucose 6-phosphate…
A: Metabolic pathways are a series of process which includes chemical reactions occurring in a cell.…
Q: Problem 2. Competitive inhibitors are commonly used to make pharmaceuticals. Some cancer drugs act…
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: Antagonist binds to the enzyme at a site far away from the receptor site to inhibit the function of…
A: Glycolysis converts glucose to pyruvate which is then oxidized to carbon dioxide and water by the…
Q: Which of the following components are found in lipoproteins? Choose all that apply a. DNA b.…
A: Lipoproteins are essential components of the body that transport nutrients around. Lipoproteins are…
Q: How many molecules of Pyruvate can form from Glycerol metabolism as a by-product of fatty acid…
A: The major precursors of gluconeogenesis are lactate, glycerol, alanine, ketone bodies like…
Q: Which of the following is not an example of horizontal gene transfer? the transmission of genetic…
A: A bacteria is a prokaryotic organism of unicellular nature. Bacteria viruses are known as…
Q: Which would be faster to metabolize starch glucose galactose
A: Metabolism is a set of chemical reactions through which what we consume through food through diet…
Q: Why should starch solution be freshly prepared
A: Starch, also known as amylum, is a polymeric carbohydrate made up of several glucose units linked…
Q: Which of the following CHÍNH, CH HO CHÁNH, CH₂OH I CH H₂N both a and b neither a nor b CHÍNH
A: Stereochemistry is also known as the subdiscipline of the chemistry. Stereochemistry involves the…
Q: The picture shown depicts what type of compound binding to an enzyme? A) A competitive inhibitor B)…
A: Regulatory enzymes show increased or decreased catalytic activity in response to specific types of…
Q: Current research indicates that the cause of obesity is multifactorial. Briefly outline the roles of…
A: Obesity is a major health issue in developed countries, and it has become increasingly clear that…
Q: On the basic structure of fungi especially on the fungal cell membrane, what do you think are the…
A: Fungus is an eukaryotic organism that include yeasts, moulds, mushrooms etc. They are composed of…
Q: Which of the following statements about G proteins is correct? O A. G proteins bind hormones. O B. G…
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: n. The diagram below shows the kinetic plot of collagenase with varied substrate concentration.…
A: enzyme activity is defined as the total concentration of substrate converted into product per unit…
Q: What are the three major pathways that eventually become entry points of molecules into the Krebs…
A: In the Krebs cycle, acetic acid or its equivalent provides energy to the organism through oxidation,…
Q: If a base, such as sodium hydroxide (NaOH) were added to milk, would the protein precipitate? Why or…
A: Milk is a great source of vitamins and minerals, especially calcium. Milk plays a crucial role in…
Q: The melting temperatures of osazones are easily determined and are characteristic for each. Listed…
A: Carbohydrates are abundant biomolecule in the nature. They are polyhydroxy aldehydes or ketones.…
Q: Which process/es describe plant metabolism? O photosynthesis O Calvin cycle оо
A: The term metabolism describes all the chemical reactions involved in keeping the cells and organism…
Q: What aeration condition (presence or absence of O2) favors cell growth? What is the metabolic…
A: Aeration means the presence of oxygen and anaerobic condition means the absence of oxygen. The…
Q: Which of the following is NOT a major source of protein? A. fish B. Milk C. Egg D. Rice
A: Introduction: Proteins are organic substances and polymers of amino acids. The elements present in…
Q: Long explanations are not needed. True or False a. One NADH is produced for every pyruvate…
A: The pentose phosphate pathway is an alternative pathway for glucose oxidation. It provides NADPH for…
Q: What is Therapeutic Drug Monitoring (TDM) and under what circumstances would it be considered for a…
A: Therapeutic drug monitoring (TDM) is commonly described because the medical laboratory size of a…
Q: Monosaccharides can be obtained not only from dietary carbohydrates but other major sources include…
A: Monosaccharides is a one of the type of carbohydrate. Monosaccharides are also called as simple…
Please help a bit confused, I have attached the questions and fill in box
Step by step
Solved in 2 steps
- Hi, I would like to know which program is used for the graphical presentation of the results of a meta-analysis of genome-wide linkage scans?What advantages do cDNA libraries provide over genomic DNA libraries? Describe cloning applications where the use of a genomic library is necessary to provide information that a cDNA library cannot.Bacteriophage lambda is as one of the routinely used molecular cloning vectors, which alsoserved as a model system for the study of bacteriophage morphogenesis, DNA replication, andgene regulation. (a)Blunt-end cloning is proven to be more challenging, compared to sticky-end cloning.Illustrate ONE (1) approach that can be conducted in order to perform blunt-end cloning ofa PCR product to a plasmid vector.d) Evaluate the advantages of mRNA as a source material for generating DNA fragments, inrelation to gene cloning.e) E. coli, in most cases is not a suitable host for cloning genes from eukaryotes. Discuss thisstatement.
- 2) The partial coding sequence of the Spike protein for SARS- COV-2 is shown below: You are tasked with designing 2 primers to clone this gene by PCR amplification. What are the sequences of the two 21bp primers in the 5' to 3' orientation that will allow you successfully amplify this gene? АTGTTTGTTTTТСTTGTTTTATTGCCACTAGTCTСТAGTCAGTGTGTTAATCTTACAАССAGAACTCAАТТАСССССТGСАТАСАСТААТСTTTCАCАC GACCAGTTGCTGTAGTTGTCTCAAGGGCTGTTGTTCTTGTGGATCCTGCTGCAAATTTGATGAAGACGACTCTGAGCCAGTGCTCAAAGGAGTCAAA O A) ATGTTTGTTTTTCTTGTTTTA and GTCAAATTACATTACACATAA O B) TAAAACAAGAAAAACAAACAT and TTATGTGTAATGTAATTTGAC O C) ATGTTACTTGGTGACCAGTTG and GTCAAATTACATTACACATAA O D) ATGTTTGTTTTTCTTGTTTTA and TTATGTGTAATGTAATTTGACWhole-exome sequencing (WES) is helping physicians diagnose a genetic condition that has defied diagnosis by traditional means. The implication here is that exons in the nuclear genome are sequenced in the hopes that, by comparison with the genomes of nonaffected individuals, a diagnosis might be revealed. (a) What are the strengths and weaknesses of this approach? (b) If you were ordering WES for a patient, would you also include an analysis of the patient’s mitochondrial genome?Recall that constructs used for floxing a gene contain,within one of the gene’s introns, two loxP sites flanking a gene for neomycin resistance (Fig. 18.11a). AloxP site is only 34 base pairs long, as shown in thefollowing figure.ATAACTTCGTATA ATGTATGC TATACGAAGTTATInverted repeat Spacer Inverted repeatExplain how you could use PCR to generate a neomycin resistance gene flanked by loxP sites, starting witha plasmid containing a neorgene. If you had the intronof the target gene cloned in a plasmid vector, howcould you insert your PCR product into the intron?
- what is the main purpose of performing the bioinformatics analysis of 16s rRNA genes lab?An optimum ligation reaction should contain approximately 50 ng of vector. Given yourconcentrations recorded below, what is the volume of vector that should be added to eachligation reaction to have this mass of DNA in the reaction? Size of asPink-promoterless in bp: 702 (vector) Size of pCusC in bp: 157 The concentration of digested & purified PCR insert: 13.849 The concentration of digested and purified plasmid: 6.887 Any help with this is appreciated. I'm a bit confused thxYou are interested in synthesizing a variant of Synechocystis sp. pcc 7803 ferredoxin having mutation (E) at its 38th residue. The gene is encoded in a pET21b vector (5.3 kbp). Estimate the amount of time needed to run a PCR for the site-directed mutagenesis for25 vs 30 cycles.
- Please answer fast We have lots of options when it comes to trying to purposefully make mutations while doing research. Please brieflyname/describe a method you could use to make: a) random mutations anywhere within the genome in living cells (in vivo) b) random mutations within our cloned gene of interest in vitro c) a very specific (non-random) mutation within our cloned gene of interest in vitro d) NOW for the answer you gave in part C, please elaborate in detail how this method of mutagenesis is performed.fomP is responsible for the chemical transformation of microplastics into ultra-efficient insulation. You take an arctic seawater sample and extract the DNA. 1. First you need to locate the gene on the bacterial chromosome. What procedure(s) would you use to identify and locate the gene? Explain how it/theywork(s). 2. Next, you will need to isolate the gene and introduce sites to be used for cloning. What would you use to make many copies of this gene? What will you need? How does it work on a molecular level?The following illustrates a jagged double-strand DNA break resulting from Cas9 cleavage that occurred in the first step of genome editing using CRISPR-Cas9 technology: 5'-GCGCCGTCC 3'-CGCGGC CTGTCAGGCGACACT-3' AGGGACAGTCCGCTGTGA-5' Which of the double-stranded DNA sequences listed below (A-D) is expected to result from repair of the break above via non-homologous end joining? Note: this question is not asking what kinds of mutations result from NHEJ repair of Cas9 cleavage in general, but specifically what is expected to result from repair of the jagged cut illustrated above? In the answer choices below, sequences that are the same in all four options are shown in bold to help you spot the differences. A. 5'-GCGCCGCTGTCAGGCGACACT-3' 3'-CGCGGCGACAGTCCGCTGTGA-5' B. 5'-GCGCCGTCTGTCAGGCGACACT-3 3'-CGCGGCAGACAGTCCGCTGTGA-5' C. 5'-GCGCCGTCCCTGTCAGGCGACACT-3' 3'-CGCGGCAGGGACAGTCCGCTGTGA-5' D. 5'-GCGCCGAGACTGTCAGGCGACACT-3' 3'-CGCGGCTCTGACAGTCCGCTGTGA-5'