Q: Explain why the process of Anaerobic Respiration is so important, (providing reference to…
A: Cells can use anaerobic respiration, which occurs without the presence of oxygen, to break down…
Q: Think of at least three ways to reduce, substitute, and eliminate from your diet foods that are…
A: Introduction Nutrition is the study of how food affects the body, and how the body processes and…
Q: Leaf tissue with sunken stomata will have ___ humidity near the stomata and ___ transpiration.…
A: Stomata It refers to the pore located in the epidermis of leaves, stems, and other organs, that is…
Q: A micronutrient required by the enzyme urease. It is a heavy metal and is toxic at higher levels.…
A: Introduction Micronutrients are essential nutrients that are required in small amounts by the body…
Q: 9) Describe the causes of sporogenesis and germination.
A: As per the guidelines, you have posted multiple questions, we will solve the first question for you.…
Q: How are fungi different from other species classifications? What is budding and why do some…
A: Fungi are a diverse group of eukaryotic organisms that include yeasts, molds, and mushrooms. They…
Q: A. For the following genotypes state the ABO blood phenotype. JAJA _ IBIO_ 1010_ |A|B_ B. Using…
A: The ABO blood group system consists of four blood types: A, B, AB, and O. These blood types are…
Q: a)What osmotic pressures do Mytilus trossulus experience? b)Do Mytilus trossulus live in isosmotic…
A: Introduction :- Mytilus trossulus is a species of mussel that is found in the coastal waters of the…
Q: The following double-stranded DNA sequence is part of a hypothetical yeast genome which contains a…
A: Introduction :- In molecular biology, a promoter is a region of DNA that initiates the transcription…
Q: In human blood types, what are the genotypes of the following parents? 1. Phenotypes of Parents A x…
A: Introduction :- A genotype refers to the genetic makeup of an individual with respect to a…
Q: How were bacterial promoters first identified? Discuss their placement within the gene and roles in…
A: Introduction :- The holoenzyme is a large molecular complex composed of RNA polymerase and…
Q: Which type(s) of organism/s does not produce enzymes needed to breakdown toxic forms of oxygen?…
A: Reactive oxygen species is a type of unstable compound that contains oxygen in them and these are…
Q: Cytokinesis occurs A. Just before telophase B. At the end of mitosis C. At the end of prophase D. At…
A: Mitosis is the process of cell division that occurs in somatic (non-sex) cells to create two…
Q: Question 15 Which statement about chordates is ACCURATE? O Not all vertebrates have a distinct head.…
A: Chordates are a diverse group of animals that are defined by certain shared characteristics. These…
Q: You have a culture of bacteria and you performed an Acid Fast staining. You see red rod-shaped…
A: Introduction - Acid-fast staining is a differential stainingused to differentiate acid fast and non…
Q: A mutation is found in a tRNA-encoding gene. The wild type (non-mutant) allele (version) produces a…
A: tRNA (transfer RNA) is a type of RNA that helps decode the genetic information in mRNA to build…
Q: One major feature of prokaryotes then distinguishes them from eukaryotes is
A: Introduction Cells are the basic structural and functional units of all living organisms. They are…
Q: You are following segregation of four genes in a cross – A, B, C, and D Dominant alleles are capital…
A: Introduction : One dominant allele combined with a recessive allele results in a heterozygous…
Q: Intercalated disks are gap junctions between cells of Group of answer choices skeletal muscle…
A: Gap junctions, "spot" desmosomes, and "sheet" desmosomes, 3 distinct types of intercellular…
Q: B. Labrador retrievers have 3 varieties of fur colour: yellow, chocolate or black. Two genes are…
A: Introduction A dihybrid cross is a genetic cross between two individuals who are heterozygous for…
Q: Does one need to take a protein supplement if they want to build muscles? Think about this before…
A: Large biomolecules and macromolecules known as proteins are made up of one or more extended chains…
Q: You're kayaking and you notice that you can see pretty deep down to the bottom of the lake. You…
A: Introduction :- The term "oligotrophic" is used to describe a lake or other water body that has low…
Q: PRE-LAB ASSIGNMENT #2: CUMULATIVE PERCENT CHANGE AND RATE PRACTICE PROBLEMS To be completed before…
A: Introduction : Osmosis is the diffusion of water passing through a semi-permeable membrane from a…
Q: Some plant substances that act as pesticides are psychoactive in humans because: insects have…
A: Some plants produce psychoactive substances, are naturally occurring substances that affect brain…
Q: Goal Phases Mitosis # Cells Produced Of the above stages, which are haploid and which are diploid?…
A: Here we need to discuss mitosis and meiosis. We know that all cell cycle stages are essential to…
Q: Give the rank of the following taxa. 1. Gasteromycetes 2. Mangifera 3. Homininae 4. Eubacteria 5.…
A: The art and science of categorization or classification is known as taxonomy. A taxonomy (or…
Q: Drug substances are useful based on their biological activity. Thus, an assay must be developed to…
A: Introduction Drug substances, also known as active pharmaceutical ingredients (APIs), are the…
Q: Name and briefly describe three major contributions that Dr. DeBakey made to medicine and biomedical…
A: Dr. Michael DeBakey was a pioneering American heart surgeon and medical researcher who made numerous…
Q: Explain why mature red blood cells become non nucleated
A: Red blood cells, also known as erythrocytes, are the most abundant cells in the blood, responsible…
Q: 4. Refer to the genetic code table to find the amino acid that is encoded by the mRNA codon CCA.…
A: Introduction The genetic code is the set of rules that determines how the nucleotide sequence of…
Q: using information about the development of the nervous system "programmed cell death" and the…
A: The programmed cell death is a crucial mechanism for the development of the nervous system and the…
Q: Which of the following is True about the STAT signaling cascade? O It amplifies signal for TGF-B…
A: Latent cytoplasmic transcription factors have been identified as STATs (signal transducers and…
Q: Lab Report 4: Photosynthesis and Cellular Respiration 2. In terms of most to least amount of…
A: Introduction Cellular respiration is the process by which cells convert glucose and other nutrients…
Q: 1. Which of the following regarding the Rab protein is false? After having supported the targeting…
A: Introduction Proteins are large, complex molecules that play many critical roles in the cells and…
Q: Question 5 In a one species the longest chromosome is four times as long as the shortest chromosome.…
A: Recombination, also known as genetic recombination, is the process by which two DNA molecules…
Q: these questions by watching the YouTube videos and reviewing the Powerpoints from Lab #4. 1. What is…
A: Microscope magnifies a very small object so that the detail of it can be seen clearly. For this…
Q: Discuss the aetiology and pathogenesis of type 2 diabetes mellitus. In your answer, make clear the…
A: Diabetes mellitus is a metabolic disorder characterized by high blood glucose levels due to either a…
Q: Many types of fishes live in freshwater. Generally, water moves by osmosis from the surrounding…
A: Freshwater fish's excretory system is in charge of eliminating waste from the body. This system…
Q: In the redox reaction below, molecule A becomes ____ and NADPH becomes ___ A + NADPH --> B + NADP…
A: Introduction NADPH stands for nicotinamide adenine dinucleotide phosphate. It is a coenzyme that…
Q: Which of the following in not an extension of Mendel's A. Codominance B. Polygonic traits C.…
A: Mendel is called the "father of genetics". In order to explain the underlying principles of Genetics…
Q: Discuss thyroid gland dysfunction with respect to increased thyroid hormone production. Provide the…
A: The name of the disorder when hyperthyroidism is caused by an autoimmune disease is grave's disease.…
Q: In the isolation of DNA, which of the following is the function of chilled ethanol? a. chelate the…
A: DNA: A polymer made up of two polynucleotide chains that coil around one another to form a double…
Q: In a species of cats, eye color can be gray, blue, green or brown. Lines that are true-breeding for…
A: Introduction :- Pleiotropy is a genetic phenomenon in which a single gene has multiple effects on an…
Q: What types of immune responses are part of your innate defence system? Select all that apply. Da.…
A: Introduction :- The innate defense system is the first line of defense against invading pathogens or…
Q: What is the difference between aerobic and anaerobic respiration?
A: Aerobic respiration requires oxygen and produces more ATP (energy) per molecule of glucose than…
Q: Option 3: It is available, so use it. The planet is changing, and we should use this to help humans…
A: Introduction :- Genetic modifications, also known as genetic engineering, refer to the process of…
Q: 11. What Objective lens should you always start with? 12. What is the purpose of the Iris Diaphragm…
A: An objective lens is an optical lens that is part of a microscope or other imaging system. It is…
Q: If all prokaryotes on Earth suddenly vanished, which of the following would be the most likely and…
A: Prokaryotes are microscopic organisms that lack a nuclear membrane and membrane-bound organelles.…
Q: Calculate the partial pressure of nitrogen (in mmHg) that would be required. Part 1.4 In planning…
A: Mesenchymal Cells: Mesenchymal stem cells (MSCs), often referred to as mesenchymal stromal cells or…
Q: If the plant is lacking true leaves, where does photosynthesis occur
A: Photosynthesis is the process by which plants, algae, and some bacteria convert light energy from…
Step by step
Solved in 2 steps
- The following is a list of mutational changes. For eachof the specific mutations described, indicate which ofthe terms in the right-hand column applies, either as adescription of the mutation or as a possible cause.More than one term from the right column can applyto each statement in the left column.1. an A–T base pair in the wild-type gene ischanged to a G–C pair2. an A–T base pair is changed to a T–A pair3. the sequence AAGCTTATCG is changed toAAGCTATCG4. the sequence CAGCAGCAGCAGCAGCAGis changed toCAGCAGCAGCAGCAGCAGCAGCAG5. the sequence AACGTTATCG is changed toAATGTTATCG6. the sequence AACGTCACACACACATCGis changed to AACGTCACATCG7. the sequence AAGCTTATCG is changed toAAGCTTTATCGa. transitionb. basesubstitutionc. transversiond. deletione. insertionf. deaminationg. X-rayirradiationh. intercalatori. slippedmispairingExplain why STR mutations are found at a much higher frequency than single nucleotide changes?At what part of the central dogma process do you think mutation occurs?
- What type of mutation is shown in the diagram? Why do you think this type of mutation is referred to by this term?In E. coli, a variety of mutator strains have been identified inwhich the spontaneous rate of mutation is much higher than innormal strains. Make a list of the types of abnormalities thatcould cause a strain of bacteria to become a mutator strain. Whichabnormalities do you think would give the highest rate of spontaneousmutation?What is the minimal number of insertions/deletions of nucleotides that would result in a frameshift mutation?
- 2. A reversion is a mutation that returns a mutant codon back to a codon that gives a wild-type phenotype. At the DNA level, this type of mutation can be an exact reversion or an equivalent reversion. GAG First GTG Exact GAG (glutamic acid) mutation (valine) reversion (glutamic acid) GAG - GTG First Equivalent (valine) reversion GAA (glutamic acid) mutation (glutamic acid) GAG First GTG Equivalent - GAT (glutamic acid) mutation (valine) reversion (aspartic acid) An equivalent reversion produces a protein that is equivalent to the wild type in structure and function. This can occur in two ways. In some cases, the reversion produces the wild-type amino acid (in this case, glutamic acid), but it uses a different codon than the wild-type gene. Alternatively. an equivalent reversion may substitute an amino acid structurally similar to the wild-type amino acid. In our example, an equivalent reversion has changed valine to an aspartic acid. Because aspartic and glutamic acids are structurally…How does a mutagen induce mutation ?explain with examples?What is a mutagen? Describe a point mutation, structuralmutation, and nondisjunction
- Name the type of mutation from the following choices: silent, missense, nonsense, frameshift. The mutation is underlined. A codon table can be reached by clicking this link. CGA to UGA O silent O frameshift O nonsense O missenseA nonsynonymous mutation is also referred to as missense mutation. Which of the following correctly describe these mutations? They are permanent and cannot revert or reverse mutate back into a wild-type sequence. They cause a non-functional amino acid to replace a functional amino acid. O They result in the insertion or deletion of a small number of nucleotides to the DNA. They change the nucleotide sequence of a gene but do not change the sequence of the resulting protein. None of the provided answers are correct. They convert a codon for a particular amino acid within a gene into a stop codon. They insert an additional amino acid into the final protein product.Define and compare the following types of nucleotide substitutions. Which is likely to cause the most dramatic mutant effect? a. missense mutation b. nonsense mutation c. sense mutation