Answered: 11. What Objective lens should you…

11. What Objective lens should you always start with? 12. What is the purpose of the Iris Diaphragm on the Condenser? 13. How do you know your Objective lens has been adjusted properly?

Principles Of Radiographic Imaging: An Art And A Science

6th Edition

ISBN:9781337711067

Author:Richard R. Carlton, Arlene M. Adler, Vesna Balac

Publisher:Richard R. Carlton, Arlene M. Adler, Vesna Balac

Chapter16: Vision And Perception

Section: Chapter Questions

Problem 6RQ

See similar textbooks

Related questions

Q: PCR technique: Describe how this substance was purified from other components in the cells?

A: PCR (polymerase chain reaction) is a laboratory technique used to amplify specific segments of DNA.…

Q: Using a good compound light microscope with a resolving of 0.3 micro meter a 10x ocular lens ,and a…

A: Resolving power: An instrument's ability to resolve two points that are near to one another is…

Q: RODAC plates will be used for which exercise? Select ALL that apply. A. Soil microbe enumeration B.…

A: Introduction : Lecithin and polysorbate, which are components of RODAC plates, a modified TSA…

Q: GGCACCTGCGATGCATGAATATATCGATCGGGAATCGCTATGTCAAGCCATGGCTAGATTA…

A: m RNA sequence is created by the enzyme called RNA polymerase that copies the nucleotides according…

Q: Which of the following is NOT a pathway of protein sorting in the Golgi? O regulated secretion O…

A: Endocytosis

Q: Population 2 Population 1 SNV 1 SNV 2 SNV 3 SNV ATGAT...GCT...GGT...TG ATGAT...GCT...GGT...TG…

A: Note: According to bartleby guidelines only first question is to be answered. So upload others…

Q: You have a culture of bacteria and you performed an Acid Fast staining. You see red rod-shaped…

A: Introduction - Acid-fast staining is a differential stainingused to differentiate acid fast and non…

Q: what is gene expression?

A: A gene is a DNA segment that contains instructions for the synthesis of a functional product, most…

Q: keep this Tro happenir waiting room, you draw the following homeostatic feedback loop to further ain…

A: Alkalosis results from alkali accumulation or acid loss. It is associated with a secondary increase…

Q: QUESTION 3 1. Which of these was the cause of the 5th mass extinction that caused the dinosaurs to…

A: Introduction Extinction is the process by which a particular species, or group of organisms, ceases…

Q: In paragraph form (about 2-3 long paragraphs), how would you characterize and identify antimicrobial…

A: Antimicrobial agents can be identified from root samples using chromatography and electrophoresis.…

Q: What are functional groups? Define monomer and polymer? What molecules are composed of polymers? How…

A: * Functional group is a part of a molecule which is recognizable or classified as group of bound…

Q: 6. Identify the following functional groups AND provide an example of one biomolecule containing…

A: Introduction Biomolecules are organic molecules that are found in living organisms and are…

Q: A: A B Madreporite C AB: D

A: Starfish: Echinoderms with a star form that belong to the class Asteroidea are known as starfish or…

Q: Explain how evolution of organisms/populations occurs as a step by step process (underline key words…

A: Evolution is the process by which species of organisms change over time, resulting in the…

Q: Which of the following epidermal growth factor (EGF) receptors cannot bind ligands but will form…

A: Epidermal growth factor (EGF) is a protein that plays a key role in the regulation of cell growth,…

Q: A mutation is found in a tRNA-encoding gene. The wild type (non-mutant) allele (version) produces a…

A: tRNA (transfer RNA) is a type of RNA that helps decode the genetic information in mRNA to build…

Q: Describe a way an injury can lead to health issues that result in environmental caused variation.

A: INTRODUCTION An injury is a physical harm or damage to the body caused by an external force. This…

Q: Describe the ethical and social issues related to population screening for genetic diseases.

A: Introduction Genetic diseases are conditions that are caused by mutations in an individual's DNA,…

Q: What are the 2 types of adaptive immunity and what types of microbes do these adaptive immune…

A: Introduction :- Immunity refers to the ability of an organism to resist disease and infections.…

Q: Rabbits were in injected with [32 P] photsphate intraperitoneally ans asacrificed after 2, 5, 8, 12,…

A: This experiment examined the process of radioisotope labeling in rabbits. Rabbits were injected with…

Q: When the ventricular walls contract A. the mitral valve opens, and the tricuspid valve closes. B.…

A: Introduction Ventricles are the two lower chambers of the heart, located below the atria. The heart…

Q: 2. The enzyme exists in two interconvertible forms that differ markedly in their activities:…

A: The enzyme acetyl-CoA carboxylase exists in two interconvertible forms that differ in their…

Q: Question: Some somatic senses are fast-adapting and others are slow-adapting. Two different types of…

A: Introduction Senses are the physiological abilities that allow humans and other animals to perceive…

Q: Which of the following correctly describes the flow of electrons during photosynthesis? Select one:…

A: The options in this question include photosystem I and II both of them are present in non cyclinc…

Q: Describe in detail the aetiology and pathophysiology of atherosclerosis. Include in your answer the…

A: Introduction :- Atherosclerosis is a chronic and progressive disease that affects the arteries,…

Q: rect! You perform a Sanger sequencing reaction. The template strand is: 5' ATCGAAC 3' However, you…

A: Sanger sequencing, also known as chain termination sequencing, is a DNA sequencing method developed…

Q: So how many activities does that make it?

A: Repairing the most common type of damage caused by UV-irradiation in human cells requires several…

Q: Identify the correct pronunciation for the term onychotomy. Multiple Choice O awn-KAW-toh-mee…

A: Onychotomy is a medical term referring to the surgical procedure of cutting or removal of the nail.

Q: QUESTION 10 Which of the statements below regarding the metabolic fate of acetyl CoA is false? a)…

A: The metabolic fate of a molecule refers to the various pathways and reactions that it undergoes…

Q: In order to visualize the fine structure of viruses and cytoskeletal filaments at 10-25 nanometers…

A: INTRODUCTION Viruses are small infectious agents that cannot replicate outside of a living cell.…

Q: Discuss the three classes of distributive shock and explain the difference in presentation of heart…

A: Introduction Distributive shock is a type of shock that occurs when there is a widespread dilation…

Q: A. How long will the coding region of the processed mRNA transcript be? (Remember that stop codons…

A: A. In an mRNA exons refer to the coding region while introns refer to the non-coding regions. During…

Q: Researchers were interested in why some children develop conduct disorder while other children do…

A: Introduction A disorder, in the context of medicine or psychology, refers to a condition that…

Q: ENZYMES CLASSIFICATION 1. OXIDOREDUCTASES 2. TRANSFERASES 3. HYDROLASES 4. LYASES 5. ISOMERASES 6.…

A: Based on their characteristics, roles, and structures, enzymes are divided into various groups. The…

Q: If the frequency of homozygous dominant is 33 the frequency of heterozygous is 33 and the frequency…

A: In genetics, the frequency of alleles refers to the proportion of a particular allele in a…

Q: . Sonography A. Define concept B. Brief history of its use C. Technical aspects Yo. physical…

A: Sonography, often known as ultrasound, is a vital medical imaging technique that use sound waves to…

Q: Which part of the immune system makes it unlikely for you to get chicken pox more than once? O a.…

A: Introduction :- The adaptive immune response is a complex defense mechanism of the body against…

Q: What process best characterizes Ca2+ movement from the cytosol (low Ca2+ concentration) into the…

A: The plasma membrane or cell membrane acts as a barrier that separates the internal and external…

Q: Differentiate the following sterilization techniques: a. Autoclave b. Dry heat c. Sterile filtration

A: Sterilization is a methodology which involves complete removal of microbes so that such microbes…

Q: If you feed a plant water in which the oxygen atoms are radioactively labeled (H2O*), in which…

A: Introduction Photosynthesis is the conversion of solar energy into chemical energy in the form of…

Q: Part A The ABO blood group locus in humans provides an example of epistasis. O True O False

A: The ABO blood group system is one of the most important and widely used blood typing systems in the…

Q: . Here is part of a gene: - 5' - 3' If the bottom strand of the DNA is the template strand, what…

A: The central dogma is a theory explaining the unidirectional flow of genetic information. According…

Q: Question 2 A patient had decreased mast cells. Which do you predict? a) decreased histamine &…

A: Introduction Mast cells are a type of white blood cell that are involved in the body's immune and…

Q: The enzyme complex called the oxygen evolving complex _____ Select one: a. breaks water, and…

A: Water is photo-oxidized during the light reactions of photosynthesis in the oxygen-evolving complex…

Q: What is the difference between an independent and dependent variable. Provide an example of each…

A: Introduction Variables are a factor or condition that can change or take on different values within…

Q: Many glomerular disorders exist due to the delicate nature of the glomerulus and the filtration…

A: The glomerulus is a delicate organ and the filtration barrier that it provides is easily damaged.…

Q: The following fictitious double-stranded bacterial DNA sequence codes for a fictitious prot Both…

A: As per the guidelines, this is a question with multi-subparts, we will solve the first three…

Q: 1. After isolating the rough endoplasmic reticulum from the rest of the cytoplasm you purify the…

A: For the most part, the endoplasmic reticulum's job is to manufacture the proteins needed for the…

Q: Choose one example of a cardiovascular imaging technique, describe how it works, and explain how it…

A: Cardiovascular imaging is a medical technique that uses different types of imaging technology to…

Concept explainers

Microscopy

Microscopy is a technical field of study about the use of microscopes to observe small objects like cells and micro-organisms that are not visible to the naked eye. A microscope is used in the field of microscopy, in order to see the object or organism that cannot be seen easily. Microscopes help us to observe the fine structure of a cell and its content.

Question

11. What Objective lens should you always start with? 12. What is the purpose of the Iris Diaphragm on the Condenser? 13. How do you know your Objective lens has been adjusted properly?

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

1. What happens if you try to use the coarse adjustment when the 10X lens is in place? 2. Assuming the light is on and the oculars are in place, what are the next 2 steps? (Answer in 3-5 sentences)
1. What happens to your image if you try to magnify it using 40x or 100x?
8.Explain what the coarse focus knob does and what the fine focus knob does. 9. What is different between the 100X objective and the other objective lenses? In other words, what does the 100X need in order to use it? please give answer for both please
2. Match each part to its function. Stage Stage adjustment knobs Light intensity knob Interpupillary adjustment Coarse focus knob Fine focus knob Iris diaphragm Condenser Condenser adjustment lever Specimen holder Eyepiece length adjustment (find the white ring) Electrical cord Closes down the amount of light, and sharpens image. Lifts or lowers the condenser; the closer to the specimen the better. Should be set so that both eyepieces are the same length. Moves a slide side-to-side and front-to-back. Changes lamp brightness. Should only be detached by holding the plug. Aligns light waves before they pass through specimen. Provides flat surface for specimens. Allows both eyes to see an image simultaneously. Holds a slide in place on the stage. Moves the stage up and down in tiny amounts. Moves the stage up and down rapidly.
Compute the total magnification. [Use 10x magnification for eyepiece]1. Scanning2. LPO3. HPO4. OIO
While looking into your compound light microscope you find that only part of the specimen is visible. What might be the cause? Question options: Insufficient illumination from the substage condenser. Iris diaphragm has not been properly adjusted. Your objective lens has not clicked fully into position. Your objective lens is dirty.
4. 5. What is the first step normally taken when you look through the ocular lenses?
16. What might happen if you used the coarse adjustment with the high power lens in place? 17. Which number on the diaphragm allows the lowest amount of light 18. What is the name of the circle of light seen through the scope?
4. What new details are you able to see on the slide when the magnification is increased to 10x that you could not see at 4x? What about 40x?
what happens when you change the objective lense
10. Why is oil used under the oil immersion lens instead of water? (1 Point) O oil is thicker than glass and so it will focus the image better O Oil is less dense than water and therefore it will help focus the image better O oil and glass both refract light at the same degree and so oil will help focus the image better O oil and air both refract light at the same degree and so oil will help focus the image better O All of the above
Why must the angle of astigmatism be determined before the corrective power of the lenses ? the corrective power is determined first , it will be difficult to determine which are blurry the corrective power is determined first , will look blurry If the corrective power is determined first , all lines will look clear .