When DNA is heated sufficiently, the strands separate. The energy that it takes to separate the DNA is related to the amount of guanine and cytosine bases. Why is this so? (A) Adenine and thymine make 3 hydrogen bonds between each other, and guanine and cytosine don't make any hydrogen bonds. (B) Guanine and cytosine make 3 hydrogen bonds between each other, and adenine and thymine don't make any hydrogen bonds. (C) It takes more energy to break an A-T bond than it does a G-C bond. (D) It takes more energy to break a G-C bond than it does an A-T bond.

When DNA is heated sufficiently, the strands separate. The energy that it takes to separate the DNA is related to the amount of guanine and cytosine bases. Why is this so? (A) Adenine and thymine make 3 hydrogen bonds between each other, and guanine and cytosine don't make any hydrogen bonds. (B) Guanine and cytosine make 3 hydrogen bonds between each other, and adenine and thymine don't make any hydrogen bonds. (C) It takes more energy to break an A-T bond than it does a G-C bond. (D) It takes more energy to break a G-C bond than it does an A-T bond.

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 12QP: DNA contains many hydrogen bonds. Are hydrogen bonds stronger or weaker than covalent bonds? What...

See similar textbooks

Similar questions

(a) (b) (c) The figure shown below is the mechanism of a DNA nuclease. The DNA molecule is in blue while the protein residues are in black (M1 and M2 are metal ions, they are irrelevant to this question). 3' Base reaction. M² 5' 00 3' Glu 357 M¹ Draw the structure of the final DNA product for this reaction. Draw a square around the nucleophile and draw a circle around the leaving group in this Does this depict the reaction of an endonuclease or an exonuclease?
Three students had a disagreement. Student A claimed a strand of DNA was one large molecule, student B said it was in fact two molecules, and student C argued it was an ordered array of many molecules. Who was correct? Or were they all correct? Explain.
How Can Fragments of DNA Be Separated From One Another? Agarose gel electrophoresis is a procedure used to separate DNA fragments based on their sizes. DNA is an acid and has many negative electrical charges due to the negatively charged phosphate-deoxyribose backbone. Scientists have used this fact to modify chromatography to separate pieces of DNA. A solution containing a mixture of DNA fragments of variable sizes is placed into a small well formed in an agarose gel (that has a texture similar to gelatin). An electric current causes the negatively-charged DNA molecules to move towards the positive electrode. Imagine the gel as a strainer with tiny pores that allow small particles to move through it very quickly. The larger the size of the particles, however, the slower they are strained through the gel. After a period of exposure to the electrical current, the DNA fragments will sort themselves out by size. Fragments that are the same size will tend to move together through the gel…
(a) Eukaryotic DNA replication is more complex than prokaryotic replication. Give one reason why this should be so. (b) Why might eukaryotic cells need more kinds of DNA polymerases than bacteria?
. In a supercoiled DNA, a stretch of about 20 base pairs changes from the B form to the Z form. What is the change in (a) T, (b) L, and (c) W?
The DNA double helix looks like a twisted ladder.What makes up each rung of the ladder?What holds the rungs together at the base? Describe its structure and its component.
What statement about DNA polarity is TRUE? One end of the chain has a 5'-OH group attached to a phosphoryl group. The other end of the chain has a free 3'-OH group, which is linked to another nucleotide. One end of the chain has a free 5'-OH group or 5'-OH group attached to a phosphoryl group. The other end of the chain has a free 3'-OH group. None is linked to another nucleotide. One end of the chain has a free 3'-OH group or 3'-OH group attached to a phosphoryl group. The other end of the chain has a free 3'-OH group, which is linked to another nucleotide. One end of the chain has only a free 5'-OH group. The other end of the chain has a free 3'-OH group. Neither is linked to another nucleotide. One end of the chain has a free 5'-OH group. The other end of the chain has a free 3'-OH group.
Which DNA double helix do you think would be harder to separate into two strands? DNA composed of predominantly or GC base pairs. Why?
In a DNA Double helix ,why doesn't an A or T form two hydrogen bonds(out of the three possible) with G or C? Explain in detail.
Which of the following two molecules of DNA melts (into single strands) at a lower temperature (Please circle)? Why? Explain your answers in terms of the strength that holds the double helix together. 3. DNA#1 DNA#2 5'ACTAGGCGAGCGTCGCCGCCAGC3' 5'AGGCAATAACTTACT3' 3' TGATCCGCTCGCAGCGCCGGTCG5' 3' TCCGTTATTGAATGA5'
45. The double helix structure of deoxyribonucleic acid (DNA) is shown above. When DNA replicates, the two strands must "unzip." Which statement describes the energy requirements and forces involved? (A) Energy must be added to break the covalent bonds. (B) Energy must be added to break the hydrogen bonds. (C) Energy is released when the covalent bonds break. (D) Energy is released when the hydrogen bonds break.
Suppose a piece of DNA is cut into four fragments of varying sizes. Where would you expect to find the larger fragments on the gel (top, middle, or bottom)? Why? Suppose you had 1000 pieces of each of the four fragments, how many bands would appear on the gel?