ich of the following pieces of DNA is going to be easier to separate into single stranded molecules using heat (ie, have a lower melting point), which breaks hydrogen bonds? Why? 1. 5’ ATTTTCCGTAAT 3’ 3’ TAAAAGGCATTA 5’ 2. 5’ ACGGTTTACCGG 3’ 3’ TGCCAAATGGCC 5’ A) 2; it has more C-G pairs which are connected by three hydrogen bonds instead of two, so they are easier to break.

ich of the following pieces of DNA is going to be easier to separate into single stranded molecules using heat (ie, have a lower melting point), which breaks hydrogen bonds? Why? 1. 5’ ATTTTCCGTAAT 3’ 3’ TAAAAGGCATTA 5’ 2. 5’ ACGGTTTACCGG 3’ 3’ TGCCAAATGGCC 5’ A) 2; it has more C-G pairs which are connected by three hydrogen bonds instead of two, so they are easier to break.

BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)

10th Edition

ISBN:9781305967359

Author:STARR

Publisher:STARR

Chapter8: Dna Structure And Function

Section: Chapter Questions

Problem 2SA: What are the base-pairing rules for DNA? a. A-G, T-C c. A-T, G-C b. A-C, T-G d. A-A, G-G, C-C, T-T

See similar textbooks

Similar questions

For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: a) the sequence of the complementary DNA strand
Give the base sequence of the complementary DNA strand of the DNA chain with the following base sequence: 5’ ACGTAG 3’
Examine the 5'- 3 sequence of bases of the DNA molecules (A D) shown below. I am only showing you the 5 - 3' strand of each molecule, but you can imagine the complementary 3' - 5' strand for each molecule. Which double-stranded molecule is held together by 10 hydrogen bonds? O AAAT O ATAG O TGTC O GCGA
List the DNA bases that will complementary base pair with the following sequence: A-G-C-T-A-C-G
A strand of DNA contains the base pair 5’-T-C-A-G-C-A-T-3’. Give the base sequence onthe complementary DNA strand.
Which of the following two molecules of DNA melts (into single strands) at a lower temperature (Please circle)? Why? Explain your answers in terms of the strength that holds the double helix together. 3. DNA#1 DNA#2 5'ACTAGGCGAGCGTCGCCGCCAGC3' 5'AGGCAATAACTTACT3' 3' TGATCCGCTCGCAGCGCCGGTCG5' 3' TCCGTTATTGAATGA5'
If one of the strands of DNA has the following sequence of bases running in the 5-S3' direction,5'-G-G-A-C-A-A-T-C-T-G-C-3' what base is closest to the 5'-end in the complementary strand?
The two strands of a DNA double helix can be separated by heating. If you raise the temperature of a solution containing the three DNA molecules below, in what order do you think these DNAs will "melt"? Explain 1)5’-GCGGGCCAGCCCGAGTGGGTAGCCCAGG-3’ 3’-CGCCCGGTCGGGCTCACCCATCGGGTCC-5’ 2) 5’-ATTATAAAATATTTAGATACTATATTTACAA-3’ 3’-TAATATTTTATAAATCTATGATATAAATGTT-5’ 3) 5’-AGAGCTAGATCGAT-3’ 3’-TCTCGATCTAGCTA-5’
In the DNA structure, a purine molecule always binds with a pyrimidine molecule. How would you expect the structure to differ if Adenine forms base pairing with Guanine and Cytosine forms base pairing with Thymidine? Instead of A-T, G-C; can it be A-G, C-T? Justify your answer within five sentences
Write the sequence of the complementary DNA strand thatpairs with each of the following DNA base sequences:(a) GGTTAC(b) CCCGAA
One strand of a double-helical DNA has the sequence 5'-GCGCAATATTTCTCAAAATATTGCGC-3'. Write the base sequence of the complementary strand. 5'- What special type of sequence is contained in this DNA segment? Hoogsteen pairing major groove O palindrome mirror repeat What alternative structure does the double-stranded DNA have the potential to form? B-DNA O a G tetraplex triplex DNA a cruciform Z-form DNA
Given several unknown solutions, you are asked to use your knowledge of nutrient tests to identify the unknown substances in the vials. The substances used to create the unknowns are: galactose, olive oil, egg white (albumin), and starch.Each unknown vial contains one or more of these substances. The results of the tests are below. What substances are found in UNKNOWN #2? * Unknown #1 Unknown #2 turns blue after turns blue after Benedict's heating in a water Reagent bath heating in a water bath Sudan IV turns bright red Indicator upon addition turns pale pink upon addition turns brown upon turns black upon Lugol's Solution addition addition turns blue upon addition turns purple upon Biuret addition Reagent Your answer