Transcribe the DNA sequence that follows. What type of molecule did you make? How many codons are there in this sequence? TACCCAACAATT
Q: What is the DNA template for the RNA sequence 5' UAACGGAGCCUAAUC 3'? O 5' GAUUAGGCUCCGUUA 3' O 5'…
A: In reverse transcription, RNA is "reverse transcribed" into DNA. This process, catalyzed by reverse…
Q: Q Search For each statement, indicate if the statement applies to only eukaryotes, only prokaryotes,…
A: All the living organisms on earth can be classified as prokaryotes or euakryotes.
Q: 5' GTGCTAGCGGGAATGAGCTGGGATACTAGTAGGGCT 3 33' САCGATCGCCCTTACТCGАСССТАТGATCАТССCGA 5' Template…
A: The DNA or deoxyribonucleic acid is the genetic material in living organisms. DNA contain genes that…
Q: Using the DNA template –TACTGGGTACAAGAACA- for transcription, what is the base sequence of the mRNA…
A: The genetic code is stored in the DNA, which is coded in the messenger RNAs (mRNAs) by a process…
Q: strand and its complementary : 5'-ATTACAG-3' umber of hydrogen bonds between strands: + TOOLS x10
A: The nucleotides forming each DNA strand are connected by noncovalent bonds, called hydrogen bonds.…
Q: What happens during transcription? Answer using 3-5 complete sentences and at least 5 of the key…
A: The central dogma states that the pattern of information in our cells is from DNA to make new DNA (…
Q: Transcribe and translate the following DNA sequence (nontemplate strand);…
A: The gene is expressed into protein by the transcription and translation step.
Q: DNA primase synthesizes a short RNA primer that later appears at the 5'-end of each Okazaki…
A: The given statement is TRUE
Q: Separate the following strand into codons: UGAAUUAUCGCG Your answer
A: Each codon is made up of three nucleotides, each of which corresponds to a single amino acid. The…
Q: COMPLEMENTARY
A: COMPLEMENTARY DNA SEQUENCE OF GACGGCTTAAGATGC is given below
Q: Directions: Transcribe the DNA sequence in the space provided. Use your notes and what you know.…
A: Transcription A process of making of mRNA from DNA. mRNA contain information about polypeptide…
Q: Translate this DNA sequence using Genetic Code 5' - ATG GGG cCC GTC CAT CCG TAC GCC GGA ATT ATA - 3'…
A: DNA is transcribed into mRNA through the process of transcription. mRNA is then translated into…
Q: C. Deepen (Pagpapalalim ng Kaalaman) Let us practice decoding DNA! Fill in the complimentary DNA…
A: DNA is what codes for all the cellular genetic information on earth . All cellular life forms from a…
Q: Write out the resulting DNA molecules after the following double stranded DNA molecule is digested…
A: DNA stands for deoxyribonucleic and. It is the genetic material present in the cell.
Q: 5-ccuaaucg-34 3'-acctgcctataccggattagetetgatectaagcatgte-5" The diagram above shows an RNA primer…
A: Given - RNA primer : B 5'-ccuaaucg-3" C Template strand : A…
Q: Separate the following strand into codons: AUGGAACCGUAU Your answer
A: Each codon is made up of three nucleotides, each of which corresponds to a single amino acid. The…
Q: If mRNA is UUACGC what is the DNA? Read from right to left. O TGCATT O UGCATU O TTUCGC UCGUTT AATGCG
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: Figure 25: MCS of PUC19 A. If the MCS were cut with Kpn I and BamH I, draw the small fragment of DNA…
A: pUC19 is a plasmid cloning vector developed by Joachim Messing. It is a 2686 base pair containing…
Q: What organism produced this gene sequence? Provide the full genus and species name. Make sure to…
A: Each organism has specific gene sequence associated with it. Given is a specific gene sequence from…
Q: DNA polymerase requires both a template, to be copied, and a primer, which provides a 3′ hydroxyl…
A: DNA polymerase is an enzyme involved in the synthesis of DNA molecules by joining the dNTPs…
Q: -35 sequence Pribnow box 5' GATTCCGTATTACAGCATAGGCTATATTCACGTGGTACGCTA 3' 3'…
A:
Q: Give the mRNA and amino acid sequence from this DNA strand: TACATACCTCGGCTTTGGCTGAAAGGTACTTATAATGCT
A: By the process of transcription the DNA strand is transcribed into mRNA within the nucleus of the…
Q: I keep getting this maked wrong, if you distinguish my mistake and explain to me in a deeper…
A: The translation is the process by which the genetic code encrypted in the mRNA gets converted to…
Q: DNA AGAGTTCTGCCCTGTCGATTT mRNA mino Acid Sequence Which kind of protein molecule did this gene make?
A: The order of amino acids from the amino-terminal to the carboxyl-terminal of a protein is generally…
Q: Use the codon wheel on page 10.11 to identify any stop codons in the stop codons. Use the codon…
A: During transcription process RNA is formed with the help of complementary base pairing with template…
Q: Using this strand of DNA (TACAACTGA), show what a substitution would look like”
A: Substitution is a type of genetic mutation in which there are three possibilities after the…
Q: 3’-TCTTCGTGAGATGATATAAGAGTTATCCAGGTACCGGTAAACTGG-5’…
A: The process of copying the information in a strand of DNA to produce an mRNA is called…
Q: 4. In what ways does the double helix explain the essential properties of a gene?
A: The structure of double helix is comparable to a ladder, with base pairs constituting the rungs and…
Q: Please check the pic. Find out where the divisions between fragments are , the number of fragments…
A: An important enzyme is EcoRI, plays an important role in recombinant DNA technology. These enzyme…
Q: From this DNA sequence DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’, change the third base in codon…
A: A mutation is a permanent and heritable change in the nucleotide sequence of the DNA of an organism…
Q: EboV from Guinea pig Reference DNA Sample mRNA Protein
A: The tiny living creatures such as bacteria, viruses, fungus, algae, and protozoa have a significant…
Q: DUE IN 30 MINUTES. This is multiple choice. No need for explanation, answer only. Thank you! A…
A: Basic amino groups (-NH2) and carboxyl groups (-COOH) are found in amino acids. Proteins have amino…
Q: Using a codon table, complete the DNA triplets, mRNA codons, tRNA anticodons, and amino acids in the…
A: Genetic code is in triplets and the codes are read by the anticodon and thus the amino acids are…
Q: Write down the double stranding sequence of the resulting DNA fragment(s) if the following DNA…
A: They enhance the rate of a reaction without being consumed or modified during the reaction.…
Q: Ruwaifa want to compares a nucleotide query sequence what option he will opt in BLAST and why?
A: BLAST is Basic local alignment search tool used to compare the queries in a DNA database. They are…
Q: BamHI Haell Both 10 kb 9 kb 8 kb 5 kb 2 kb 1 kb Figure 2 (i) How long is the original DNA molecule?…
A: Restriction digestion is a process in which DNA is cut at specific sites,
Q: Given the template DNA strand 3’-TACCCTCAAGGGCAAACT-5’, provide the complimentary DNA strand, mRNA,…
A: DNA is the genetic material of almost all living organisms. The DNA is inherited from the parents…
Q: In a genome project, the following genomic DNA sequences were obtained. Assemble the sequences into…
A: Genome of an organism includes all the cellular DNA of the organism; including nuclear, chloroplast…
Q: Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain,…
A: The central dogma involves two processes to bring about gene expression, namely transcription, and…
Q: What happens during translation? Key Vocabulary from Unit 4.2 Answer using 3-5 complete sentences…
A: Translation The process of making a protein from the information contained in a molecule of…
Q: MUTATION: Fill in the correct nucleotide base pairing and amino acid sequence of the mutated DNA…
A: Introduction A mutation is a change in an organism's DNA sequence. Mutations can be caused by errors…
Q: list the RNA sequence transcribed from the DNA template sequence TTACACTTGCTTGAGAGTC
A: DNA is a double-stranded molecule that stores the genetic information in the form nucleotide…
Q: Template strand: 5'.GTCTCTTGACATTG... 3' if the nucleotide highlighted in yellow is mutated to a C,…
A: A silent mutation is a change of the succession of nucleotide bases which establishes DNA, without a…
Q: DIRECTION: Complete the DNA and RNA sequencing for the translation and creation of proteins. 1. DNA…
A: Transcription Cellular process in which RNA is synthesized using DNA as a template known as…
Q: Evaluate the mutation below. Original DNA strand: 3'-TACTTACGCACGGCCACT-5' Amino acids produced:…
A: From the DNA sequence the mRNA is produced within the nucleus of the cell by the transcription…
Q: Using the figure below identify: What is a function of introns and exons? What is a role of mobile…
A: DNA is packed up compactly in the nucleus of a cell in close association with histone proteins…
Q: a. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS…
A: A sense strand, also known as a coding strand, is a stretch of double-stranded DNA that carries the…
Transcribe the DNA sequence that follows. What type of molecule did you make? How many codons are there in this sequence?
TACCCAACAATT
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- Below is a sequence of DNA. 5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' How many codons are in the longest ORF? What is the frame of the shortest ORF? How many AA are in the shortest ORF?Below is a sequence of DNA.5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' How many "reading frames" can be identified for this sequence? How many "open reading frames" can be identified for this sequence? What is the frame of the longest ORF? How many codons are in the longest ORF? What is the frame of the shortest ORF? How many AA are in the shortest ORF? Using the one letter code for Amino Acids, what is the predicted AA sequence of the shortestORF (from N to C-terminal end)? Using the one letter code for Amino Acids, what is the predicted AA sequence of the longestORF (from N to C-terminal end)?No drawings just writing the answer a) Replicate this sense strand to create a double-stranded DNA helix TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT b) Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by using the correct reading frame. When you get to the stop codon – you may write an asterisk (i.e. a “*”) to denote the stop codon. c) Does the sense strand DNA sequence have 5’ and 3’ UTR sequences? If so – write them in the space below 5’ UTR: 3’ UTR:
- Need help! Use the first picture and codon table to answer the following the questions.Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first C): ATGCTGCGAAACTTTGGCTGA Provide the 6 DNA codons that would be read following the mutation. Are they the same as the original 6 DNA codons that would have been read? Edit Vicw Inscrt Format Tools Tablc Paragraph BIUA 2 T 12ptvTemplate strand: 5' AATCATAACTCATTG 3' A. Write the CODING strand of this sequence, including the 5' and 3' end designations. B. Write the amino acid sequence coded by this mRNA. The start codon is the first codon in the sequence that codes for Met. First position (5'-end) U < G บบบ UUC phe UUA UUG CUU Couleu CUC Coc CUA CUG AUU AUG AUC ile GUU GUC GUA GUG Second position C UCU UCC UCA UCG val CCU co CCC CCA 000 CCG ACU ACC ACC AUA ACA thr AUA ACA AUG met ACG GCU GCC ser GCA GCG pro ala UAU ORD tyr UAC UAA Stop UAG Stop CAU CAC CAA CAG - AAU AAC www AAA 10 asn AAG 7 his GAU GAC GAA GAG gin }| lys asp glu UGU UGC cys UGA Stop UGG trp CGU C00 CGC CGA 000 CGG AGU AGC ACA AGA AGG GGU GGC GGA GGG Initiation Termination arg ser arg gly DUAL SUAU DUAU DUAG Third position (3-end)
- 5' GTGCTAGCGGGAATGAGCTGGGATACTAGTAGGGCT 3' 3' CACGATCGCCCTTACTCGACCCTATGATCATCCCGA 5' Template Strand: 9. Using the template strand, transcribe the DNA above, Be sure you write your sequence 5 - 5 a indicate the 5' and 3' ends of any nucleic acid molecule(s). 10. Use the codon chart below to translate your mRNA into an amino acid sequence. Begin at the first codon. Third First position (5' end) Second position position (3'end) UGU Cys UAU Tyr Cc UGC Cys UGA Stop UGG Trp UCU Ser -Y UAC Tyr UAA Stop UAG Stop UUU Phe - F UUC Phe UUA Leu UUG Leu FL UCC Ser -- UCA Ser UCG Ser CGU Arg CGC Arg ER CGA Arg CGG Arg CCU Pro CAU His CUU Leu CUC Leu -- CAC His CAA Gln CAG Gln CCC Pro -P A - CUA Leu CUG Leu CCA Pro CCG Pro AAU Asn AAC Asn AGU Ser AGC Ser AGA Arg ACU Thr AUU lle AUC lle AUA lle AUG Met M ACC Thr -T ACA Thr ACG Thr A. AAA Lys K AAG Lys -R AGG Arg A. GAU Asp -D GAC Asp GGU Gly GGC Gly GCU Ala GUU Val GUC Val GCC Ala A -G GGA Gly GGG Gly A -V GUA Val GUG Val GCA Ala GCG Ala GAA Glu -E…Examine Table 15-2. Which amino acids are coded by the following codons? (Hint: For the first base [letter] in each of the codons listed below, look at the leftmost column of the table labeled “First Base.” For the secondbase in each codon, look at the top row of bases, and for the third base, look at the column on the right-hand sideof the page).a. UUUb. UCUc. UAUd. UGCe. CUUf. CGAg. CGGh. AAAi. AAGj. GAGk. GGUl. GGCm. GGAn. GGGTranscribe and translate the mutated sequence #3. Determine the consequence, if any, for each mutation. You will need to use your codon charts in your ISN. Practice with both charts.
- oseg 1su Third Base ne following questions refer to Figure 17.2, a table of codons. Second Base nnn UUC UAU non Tyr UCC UAC UGA Stop dois UGG UUA JOS UCA UAA ne UUG UCG UAG di dois CCU CAU CGU CUC SIH CGC CCC CAC CUA no7 CGA CCA Old CAA CCG CAG CGG AAU AUC JOS USV AGC ACC AAC AUA ACA AAA AGA AUG Met or Start Lys ACG AAG GCU GAU dsy GGC GUC GCC GAC Ala Gly GUA GCA GAA GGA GUG GCG GAG GGG Figure 17.2 A peptide has the sequence NH2-phe-pro-lys-pro-gly-phe-pro-COOH. Which Of the following sequences in the coding strand Of the DNA could equal the code for this peptide? a. 5' GGG-AAA-TTT-AAA-CCC-ACT-GGG b. 5' TTT-CCC-AAA-CCC-GGG-TTT-CC c. 3' AUG-AAA-GGG-TTT-CCC-AAA-GGG d. 3' UUU-CCC-AAA-GGG-UUU-CCC e. 5' TTT-CCC-AAA-GGG-TTT-CCCThe sequence below is a template strand sequence for a gene (a very short one!). Identify the start codon and the amino acid sequence of this gene. Write your answer in 3 letter amino acid code. Put a hyphen between each amino acid. You should also include a description of any working or steps you have taken to determine your answer. 5' AGTCAGCAAGAAGACATCAGTGTTCCCATCTGT 3' Paragraph V B I U A = 8⁰ + v 11.BamHI cut sequence: G//GATCC and each sequence is 250 nucleotides long. How many DNA segments would be created by cutting the normal gene with BamHI?