Protein 2:DNAAGAGTTCTGCCCTGTCGATTTMRNAAmino AcidSequence1. Which kind of protein molecule did this gene make?2. How does this protein help the body maintain homeostasis?

Name: Protein 2:DNAAGAGTTCTGCCCTGTCGATTTMRNAAmino AcidSequence1. Which kind
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Protein 2:DNAAGAGTTCTGCCCTGTCGATTTMRNAAmino AcidSequence1. Which kind of protein molecule did this gene make?2. How does this protein help the body maintain homeostasis?

The order of amino acids from the amino-terminal to the carboxyl-terminal of a protein is generally…

Answered: DNA AGAGTTCTGCCCTGTCGATTT mRNA mino…

Science

Biology

DNA AGAGTTCTGCCCTGTCGATTT mRNA mino Acid Sequence Which kind of protein molecule did this gene make?

Anatomy & Physiology

1st Edition

ISBN:9781938168130

Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble

Publisher:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble

Chapter3: The Cellular Level Of Organization

Section: Chapter Questions

Problem 27RQ: Arrange the following terms in order of increasing specialization: oligopotency, pleuripotency,...

See similar textbooks

Similar questions

Name: Date: 2. The sequence of a fragment of one strand of DNA is AATTGCATATACGGGAAATACGACCGG. Transcribe this s sequence into MRNA. er bns eldst eboo oi ebitqeqylog erlt to noihiog eri qu elsm bluow tsri abios onime Jlaw as ye s 1ot noitem atelomet AHG 3. The following MRNA ştrand is being used to asemble a polyp
AKS 5c1: Which of the following models BEST represents protein synthesis? * O MRNA (UAC AAA) - DNA (ATG TTT) Amino Acid Sequence (Lysine-Alanine) - Amino Acid Sequence (Methionine- DNA (TAC AAA) RNA (AUG UUU) Phenylalanine) RNA (AUG UUU) DNA (TAC Amino Acid Sequence (Methionine-Phenylalanine) AAA) DNA (AUG UUU) RNA (TAC AAA) Phenylalanine) - Amino Acid Sequence (Methionine- AKS 5c1: Using codon wheel below, which of the models correctly represents the usage of the base pairing rule, the correct sequence of events, and creation of proteins at the ribosomes? *
AKS 5c1: Given the statements below, what is the correct sequence of events for protein synthesis? * 1. DNA is used as a template to create mRNA 2. Amino acids are bonded together to make a polypeptide 3. MRNA molecule binds to a ribosome 4. The ribosome releases both the mRNA molecule and the polypeptide 5. TRNA binds to the ribosome O 1, 2,3, 4, 5 1,3, 5, 2, 4 2, 4, 1, 5, 3 4, 2, 1, 5, 3 AKS 5c1: The model below represents the process of protein synthesis. What is
AKS 5c1: Which explanation accurately describes the model below? * DNA MRNA Transcription Mature MRNA Nucleus Transport to cytoplasm for protein synthesis (ranstation MANA Cell membrane This model represents protein synthesis since the tRNA is delivering amino acids to form a polypeptide chain that will form a protein. This model represents protein synthesis since the tRNA is delivering lipids which will be used to bond proteins to form an enzyme. This model represents protein synthesis because DNA is being copied during transcription in the nucleus before leaving the nucleus. This model represents protein synthesis because MRNA is coiling to form a new protein molecule in the cytoplasm.
BONUS: In Bacteria, recognizes the Ribosomal Binding site on mRNA and catalyzes formation of peptide bonds during translation (answers must be in correct order) O aminoacyl tRNAses; aminoacyl TRNA synthetases ribosomal protein translation factors; ribosomal protein initiation factors O helicase; gyrase O 165 rRNA; 23S rRNA
Arrange the following terms in order of increasing specialization: oligopotency, pleuripotency, unipotency, multipotency. multipotency, pleuripotency, oligopotency, unipotency pleuripotency, oligopotency, multipotency, unipotency oligopotency, pleuripotency, unipotency, multipotency pleuripotency, multipotency, oligopotency, unipotency
Direction: Study the given amino acid sequence and DNA sequence of the Amino Acid Sequence: LEU-ISC-PRO-PRO-PHE-ILE-LEU-LEU-SER-HIS-LEU-LEU-SER What's More Activity 3.1 Check and Relate listed organisms. Cat DNA Sequence: TTAATCCCCCCGTTTATCCTACTTTCCCATCTACTAAGT Am no Acid Sequence: LEU-ISC-PRO-PRO-PHE-ILE-LEU-EU-SER-ARG-LEU-LEU.AD DNA Sequence: CTTATCCCCCCGTTTATCCTACTTTCCCGTCTACTTCGT Shark Amino Acid Sequence: LEU-ISC-PRO-PRO-PHE-ILE-LEU-LEU-SER-HIS-VAL-VAL-SER DNA Sequence: CTAATCCCCCCGTTTATCCTACTTTCCCATGTAGTAAGT Colphin Amino Acid Sequence: LEU-ISO-PRO-PRO-PHE-LE-LEU-LEU-SER-ARG-LEU-LEU-ARG DNA Sequence: CTAATCCCCCCGTTTATCCTACTTTCCCGTCTACTTCGT Lizard Amino Add Sequence: ISO-4SO ASP-GLN-PHE-ILE-LEU-HIS-SER-ARG-LEU-LEU-ARG DNA Sequence: ATTATCGACCAGTTTATCCTACATTCCCGTCTACTTCGT Sponge Activity Questions: 1. Which organisms are closely related to each other? How are they related? 2. What does this tell us about the organisms and their ancestors? 3. How amino acid sequences and DNA…
Directions:Sequence the following steps in protein synthesis from first to last. Write only thenumbers (1-6) on space provided for; ____a. transcription____b. tRNA amino acid____c. amino acids separate from tRNA____d. polypeptide chain assembled____e. mRNA links to ribosome____f. stop codon encountered in mRNA
SspI --- 5' AAT - ATT 3'5' GGATAATATT GTTAACAATCTCTACGGGTTAACACCCTTGGAATATTTTAA 3' 3' CCTATTATAACAATTGTTAGAGATGCCCAATTGTGGGAACCTTATAAAATT 5' Number of pieces of DNA _______
Name: Clas: Date: Transcription 3" ATGACGGATCAGCCGCAAGOCGGAAfTGGCGACATAA UACUGCCUAGUCGGCGUU 3 5' WA WAW TACTGCCTAGTCGGCG TCGCCTTAACCGCTGTATT 3' 6 Label the diagram as you read the following passage. Transcription is the process cells use to copy information from DNA into messenger RNA copies. Part of the chromosome's tightly wound-up long strand of DNA is "loosened" to allow for RNA polymerase room to copy part of the DNA. Think of this as opening a page out of a giant book with thousands of pages to make a copy of just that one page. One side of the DNA strand is the template strand (or anti-sense strand) and is used by an enzyme called RNA Polymerase to create the messenger RNA. RNA Polymerase is directed by a bunch of proteins called transcription factors to the spot it needs to start copying. RNA Polymerase reads the template strand from the 3' end to the 5' end and creates a messenger RNA strand that is complementary to the template strand. In the diagram above, you can see that…
Order+the+following+of+protein+sentesis+sequence+from+earliest: (a)tRNA molecule bring specific amino acids to he mRNA molecule. b)mRNA nucleotides join with exposed DNA bases and form a molecule of mRNA.(c)The two stands of a DNA molecule separate. (d)Peptide bonds form between the amino acids. (e)the mRNA molecule leave the nucleus. (f) a ribosome attached to the mRNA molecule.
C. Temination Step 2- Draw (DO NOT COPY-PASTE Images from the Internet) a picture of what is happening in each step in the box labeled "illustration." Label the following structures in each drawing where appropriate: DNA, MRNA, nucleus,cytoplasm, ribosome, rRNA, RNA, amino acid, polypeptide chain Step 3 - Describe (IN YOUR OWN WORDS) what is happening in each step in the box labeled "description." Be sure to include which process (transcription or translation) is being shown and where the process takes place (nucleus or ribosome). Transcription - Initiation Illustration Description A initiation is the beginning of transcription promoter RNA polymerase Transcription - Elongation 1 / 4 Q + Page 近