(Theme 5) You are studying the role of a gene called stop. When expressed, stop appears to inhibit cellular processes controlled by another gene, Bisc219. To probe the molecular mechanism of stoP-mediated regulation of Bisc219, you begin by assaying bisc219 expression at the mRNA and protein levels. Your results are shown below. long short bisc219 mRNA stop no stop expressed | | long short Bisc219 protein stop no stop expressed a) Propose and briefly explain a specific molecular mechanism through which stop could operate, assuming that stop encodes a small RNA. Your answer should specify a specific molecular interaction(s) involved in gene expression that is/are disrupted. b) Propose and briefly explain a different molecular mechanism through which stop operates, now assuming that stop encodes a protein.

(Theme 5) You are studying the role of a gene called stop. When expressed, stop appears to inhibit cellular processes controlled by another gene, Bisc219. To probe the molecular mechanism of stoP-mediated regulation of Bisc219, you begin by assaying bisc219 expression at the mRNA and protein levels. Your results are shown below. long short bisc219 mRNA stop no stop expressed | | long short Bisc219 protein stop no stop expressed a) Propose and briefly explain a specific molecular mechanism through which stop could operate, assuming that stop encodes a small RNA. Your answer should specify a specific molecular interaction(s) involved in gene expression that is/are disrupted. b) Propose and briefly explain a different molecular mechanism through which stop operates, now assuming that stop encodes a protein.

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

You continue to study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 1 20 ORI 40 60 TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC AAGCTCGAGAGCAСCAGCTСТАТGCGСТАСТАТААТGAССАКТАТАСССТАCGTGATAG 5" 3' RNA promoter polymerase 4a. Was this micrograph taken of a sample prepared from human cells or prokaryotic cells? How do you know? 4b. What is the sequence of the first 10 nucleotides of the transcript of this gene? 5' 3' --- 4c. What are the first 5 amino acids encoded by this gene? )Note - there is a codon table available at the beginning of this exam. N' C' 4d. Will translation stop at the UAA which begins at position 41? Explain your logic 4e. You also study the expression of 3 different mutants for this gene. For each mutant answer the following: Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new…
You study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 1 20 ORI 40 60 ТТCGAGCTCTСGTCGTCGAGATACGCGATGATATTАСТGGТААТАТСGGGАTGCАСТАТС 3' 5' AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCATTATAÇECCTACGTGATAG ΤΑTC promoter RNA polymerase Practice Question 4 C) What are the first 5 amino acids encoded by this gene? N' C' ribosome
You study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 1 20 ORI 40 60 AGATACGCGATGATATTACTGCTA AAGCTCGAGAGCAGCAGCTCТАTGCGCTACТАТААТGACCАТТАТАССССТАCGTGATAG 3' TТCGAGCTCTСGTCGTCGAGA ПААТАТСGGGATGCАСТАТ С 5' RNA promoter polymerase Practice Question 4 G) You also study the expression of different mutants for this gene. Mutant C has had the first 5 base pairs deleted (position 1-5). Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new sequence. If it does not change the protein sequence, what effect (if any) would you expect it to have on expression of the gene? For mutant C answer the following: Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new sequence. If it does not change the protein sequence, what effect (if any)…
You study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 1 20 ORI 40 60 TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAA! AAGCTCGAGAGCAGCAGCTСТАTGCGCTAСТАТААТGACСАТТАТАССССТАСGTGATAG 3' СTGGIAATATOGGGATGCACTАТС 5' RNA promoter polymerase Practice Question 4 F) You also study the expression of different mutants for this gene. Mutant B has a 2 G/C pairs inserted between position 19 and 20 (position denoted by the ^ in the sequence above). For mutant B answer the following: Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new sequence. If it does not change the protein sequence, what effect (if any) would you expect it to have on expression of the gene? 1 20 ORI 40 60 3'...TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC...5' 5'..AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCATTATACCCCTACGTGATAG...3' promoter m in…
Wilms tumor 1, or nephroblastoma, is caused by mutations in the WT1 gene, which encodes a transcription factor. You have identified a novel variant in WT1: Arg422Pro. You have control cells and cells that have been engineered to carry the homozygous WT1 p.Arg422Pro mutation. You want to assess effects of this mutation on a variety of endpoints. For each endpoint listed below, choose the one technique is best suited to answer the question. Choose from: array CGH, qRT-PCR, qPCR, RNA-seq, FISH, in situ hybridization, western blot, immunostaining, WT1 ChIP-seq, WT1 ChIP-PCR, ATAC-seq, 3C Endpoint Technique? WT1 protein amount (quantitative) Western blot WT1 protein binding to all enhancers, genome-wide Chip-seq WT1 mRNA amount (quantitative) WT1 protein subcellular localization Quantitative assessment of all mRNAs in these cells (genome-wide) RNAseq Chromatin interactions between a specific WT1 chromatin binding site (identified above)…
You study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 20 ORI 40 60 3' ТТCGAGCTCTCСТCGTCGAGATACGCGAT SCGATGATATTAC: ТАСTGGTAATАTоGGGATGCACTAТС AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCANTATAÇCCCTACGTGATAG ΤΑTC 5' promoter RNA polymerase Practice Question 4 B) What is the sequence of the first 10 nucleotides of the transcript of this gene? 5' 3' ribosome
Briefly discuss (referring to the images provided) why mutant 2 fails to produce functional protein. Note that none of the mRNA transcribed from this gene is of the expected size; some of the mRNA molecules produced are 223 nucleotides shorter than expected, whilst others are 47 nucleotides longer than expected.
Select from the drop-down menu which type of regulation is occurring in each case. The Ixb12 gene sequence is in a region of condensed chromatin in fetal heart cells, but in adult heart cells, this region is uncondensed. This is an example of choose your answer... regulation. The Ixb12 protein is activated by a kinase, which is an example of choose your answer... regulation. Trx25 mRNA is targeted for degradation by a protein that is present in liver cells but not in heart cells, which is an example of regulation. The Trx25 protein is inactivated by a protein that removes its phosphorylated residues, which is an example of choose your answer... choose your answer... regulation.
() What is the function of RISC in eukaryotic gene expression? (i) Nose encodes a transcription factor that regulates late flowering in Barbados Pride. Using the nucleotide sequences of MIRNA490 and the 3' end of NOSE MRNA below, show how RISC can affect the expression of NOSE protein. MIRNA490 5' UAGUCAGCGUUCGCACAU 3 NOSE MRNA 5 UCAUGUGCGAACGCUGACUAGGAAAAAAAA 3
Imagine the same cells as above that has 20,000 molecules of estrogen receptor at the start of your experiment. You treat the cell with alpha amanitin, but forgot to add cycloheximide. The steady state level of estrogen receptor mRNA transcripts in the cell is 200. Ecah transcript takes two minutes to be translated into estrogen receptor protein. Assuming none of the ER mRNAs in the cell decay during the course of the experiment, at your 1 hour time limit, how many ER proteins will be present in the cell treated with only alpha aminitin?
S-Cdk is likely to be a [Select] The inhibitor of Ras is likely to be a [Select] The MAP kinase is likely to be a [Select] Q Search 14:31 Protein X is a transcription factor that normally activates the expression of genes needed for S- phase. The activator of protein X is likely to be a [Select] is 4 ******* > 21**113 ***** ****** V f6 99+ 1- Il app.honorlock.com is sharing your screen. **** 1 a hp Stop sha
Bong Question #1: The diagram below depicts the regulatory regions for two (made-up) genes, which contain cis-regulatory sequences X, Y, and Z and bind to transcriptional regulatory proteins: zelo led diogot bolgate SMARTY – a transcriptional ACTIVATOR protein, which is present in all neuronal cells and binds to cis-regulatory sequence, X1oq & vino 19vewod.152 moldong sai mut tum BRAWNY-a transcriptional ACTIVATOR protein, which is present in all muscle cells and binds to cis-resgulatory sequence, Yolgulum di ko malo na SNARKY - a transcriptional REPRESSOR protein, which is present in peripheral neurons only and binds to cis-regulatory sequence Z 100 bio se i da se lotimo broup gniwollt od 19 bolgate ons zegg or we de base do no me to stir noitesup od went of sistemos seu anoitesup 15wens horle 10oldog woy ni gnius stoted 1910 ni tatayot ovizasovo got no rade od lliw anioq azia oo ingene Aroom or b X y Jeol VELY gan 100 Tonnodige ΤΑΤΑ, 229nibrow dong H .aodto diw atse meldong mov.no o…