The base sequences of DNA from two different individuals, Alice and Ben, are given below. Indicate where BamHI and EcoRI would cut these DNA sequences by drawing lines (for hints refer to FIGURE 2 and the video in the Canvas assignment for this section ). Personal use ofty 2021-05-12 forevermaya16@gmail.com BEN ALICE G C G C G C G C G C ce se only, do notep 2021-05-12 AT tom ermaval6@gTA C G ΑΤ TA C G C G G C C G G C G C A T Pers A T use only, do not reproduce. А Т А Т 2021-05-12 AT ТА TA C G vermaya16@gmail.com ТА ТА C G Does BamHI cut the DNA from Alice and Ben in the same place? Personal use only, 0o not reproduce 2021-05-12 How about EcoRI? forevermayal6@gmai.com

The base sequences of DNA from two different individuals, Alice and Ben, are given below. Indicate where BamHI and EcoRI would cut these DNA sequences by drawing lines (for hints refer to FIGURE 2 and the video in the Canvas assignment for this section ). Personal use ofty 2021-05-12 forevermaya16@gmail.com BEN ALICE G C G C G C G C G C ce se only, do notep 2021-05-12 AT tom ermaval6@gTA C G ΑΤ TA C G C G G C C G G C G C A T Pers A T use only, do not reproduce. А Т А Т 2021-05-12 AT ТА TA C G vermaya16@gmail.com ТА ТА C G Does BamHI cut the DNA from Alice and Ben in the same place? Personal use only, 0o not reproduce 2021-05-12 How about EcoRI? forevermayal6@gmai.com

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter18: Dna Technologies: Making And Using Genetically Altered Organisms, And Other Applications

Section: Chapter Questions

Problem 9TYK

See similar textbooks

Similar questions

Restriction Enzymes Handout plasmid Restriction Enzymes Bam HI Eco RI Hpa I Hind III Nde I Please solve this question in less than 15 minutes for genetics engineering Sal I Plasmid Handout DNA Sequence (both strands are represented) GIGATCC CCTAG G U G|AATTC CTTAA G GTT | AAC CAAjTTG A|AGCTT TTCGA | A CATATG GTATAC G|TCGAC CAGCT | G agtgacata tga ttcgag c cggta a c tca ctgtat a ст aagctcgagccattg cggggat cctctag agtcgacctgcagg c gcccctaggagatctcagctgga cgtc cg tagca ag c tggcgt at atggta cata at cgttcga accgcattagtaccat gta t gggatceptet ct ccagtaggtaggc cgtcg ccct agga aga g g t catccat cc ggcag c Antibioty Resistance gene gc taggetta a actgggatccat gcc origin o tplgm cg at cc a at ttgaccctaggta cgplasmid replication What is the role of the plasmid ? Explain the experimental details of the transformation. How can the success of transformation be observed ?
Kha Vu Danels Include: 8DX : Safehy Jor bromie tnto lab repart! Name Section date sheet MAPPING PRACTICE #1 Below is a restriction map for the plasmid PGEN 101 (total length = 20 Kb). Using this map as a guide, give the number of restriction fraqments along with their associated lengths that would result from digesting PGEN 101 with the restriction enzymes EcoRI, BamHI and a combination of ECORI and BamHI. BamHI 3.2 Kb 1.7 Kb EcoRI BamHI PGEN 101 8.7 Kb 5.5 Kb .9 Kb EcoRI ECORI DIGESTION PERFORMED SIZES OF FRAGMENTS OBTAINED 10.4 kb , 0.9kb, 8.7 Kb EcoRI 3.2 Kb, 16. 8kb BamHI EcoRI + BamHI
15/doc.aspx?sourcedoc={dac0ebeb-b019-4578-911c-98.. Search (Option + Q) Review View Help Table O Editing er Av A =
☆回 w Insert Format Tools Add-ons Help Last edit was yesterday at 8:08 AM TURN 100% Normal text Arial 11 BIUA E- 1E E E - E EX 2. 3 . 5. C Directions: Describe the process of DNA replication in the space below. Specifically reference the pictures in your answer. Your response will undergo a plagiarism check. Be sure to write your response in your own words. Be sure to reference and thoroughly explain: The relationship and importance of DNA replication and the cell cycle. The conservation of genetic information during replication. (Is it conservative? Semi-conservation? Dispersive? What does this mean?) The specific enzymes used in each step and indicate whether each of the enzymes is a synthesis reaction or a digestion reaction. Justify your answer through explanation. Identify the parameters and limitations of the enzymes working effectively. (What factors would limit or interfere with DNA replication?)
PCHEM4321. An agarose gel electrophoresis pattern of the plasmid PSPM4321 digestion (restriction) is shown below. Draw a restriction map of a plasmid with the appropriate restriction sites based on the data given below. Hindlll Hindll BamHI +BamHI Figure 1: 1% agarose gel electrophoresis of pCHEM4321 40 24 16 12 12 8 4 4 + |
B 6000 5100 Number of Fragment(s) 4000 100 pX 6000 bp 3000 A A 1500 2000 A B 10. Based on the restriction map of the above plasmid, determine the number of DNA fragment(s) and the size(s) of the fragment(s). Digestion with Enzyme A Enzyme B Enzyme C Enzyme A + B Enzymes A + C Enzyme B+ C Enzyme A + B + C Fragment size(s) in base pairs
What type of molecule or cell is PGLO? C Origin region Arabinose operon arac ori Ndel Promoter PaaD PGLO (5,400bp) Ndel Ampicillin Resistance Gene Amp Hindll Ndel Green Fluorescent Protein (GEP) Gene Hindll 'ECORI GraphiceESchmid/2003 D O virus O RNA plasmid molecule O DNA plasmid moelcule O none of the choices are correct
Synthetic polylinker Hindill EcoRI sticky end 5 AATTCCTGCAGAAGCTTCCGGATCCCCGGG CITAA Plasmid cloning vector (cleaved with Eco) GGACGTCTTCGAAG GCC TAGGGG CCCTTAA AATTC Psti Hindi Nelson & Co, Leninger Principles of Biochemistryde ©2021 WH Freeman & Company BamHI Smal EcoRI sticky end Enzyme Polylinker transferase; 2 ligase; 6 lyase; 6 lyase; 4 ligase; 4 BamHi Smal CITAAG GRATT C EcoRI Which pairing correctly matches the enzyme class and Enzyme Commission number for the enzyme that catalyzes this reaction?
Coding With the given coding strand perform the following 1. supply the correct non- coding strand 2. Identify the location of following restriction enzyme by enderlining it in the coding strands 3. Supply the correct non-coding strands for the two restriction enzymes EcoRi - 5' GAATTC 3'BamH1 - 5' GGATTC 3' 5' ATGCATGGTACGTAGAGTTCCATGAATTCGCCCCTATAGGGTAGCCGAGGATTCTATGCCCGAATGTC 3'
U have the plasmid pUC18/19, which is a circular plasmid that consists of 2686 bp. What would the number of and length of the fragments be if you cut the plasmid with the following restriction enzymes or combination of enzymes? Give a schematic representation of the digestions. PscI & GsuI ______________________________________________________________ ScaI, PdmI & BsaXI ______________________________________________________________ ScaI, SspI & EheI ______________________________________________________________
ull rain LTE 11:53 © 1 0 A 10% Done #1 Mol Bio Restriction Analysi... Complete the following problems. Restriction enzymes (REs), which cut D NA at specific sequences, are classic tools in molecular biology. Because of their specificity in cutting DNA, REs can be used to "map" DNA sequences by analyzing the fragments generated upon restriction digest, as in the example shown in Figure 1. Your task is to study the circular plasmid, pMBBS, through restriction digests. You subjected the PMBBS plasmid to complete digestion by different combinations of three REs (EcoRI, BamHI, and Xhol), and analyzed the results on an agarose gel, shown below. Using the data you can glean from this gel, answer the questions that follow. EcoRI BamHI Xhol DNA size ladder 600 bp 500 bp 400 bp 300 bp 200 bp 100 bp VC 100bp Plus DNA ladder from Vivantis Technologies *The same total amount of DNA was loaded in each lane. 1. What is the total size of the PMBBS plasmid in bp? Answer: bp 2. How many cut sites on the…
A amp PBR322 4301 fot B Clear Zones Figure 2 The postgraduate student, Demika, inserted her gene of interest into the plasmid, pBR322, before transformation into the competent host cell using heat shock method. After that she cultured the cells on the Ampicillin agar plate before replica plating the colonies onto another Ampicillin (A) and Tetracycline (B) agar plates shown in Figure 2. (1) Referring to the vector pBR322 in Figure 2, which recognition site was cleaved to insert the gene of interest? Based on the observation above, can you identify which colonies are carrying positive mcombinants of BR322? Explain your selection.