Refer to Figure 9.7, then translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the first base: 5′—UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU—3′
Q: A Section of a Gene CTA AAA TAG TCT For the DNA sequence shown above, identify the following: mRNA…
A: A biological process in which the information present in DNA is copied to RNA (mRNA) is known as…
Q: DNA sequence
A: This is defined as the process in which cells make proteins. This occurs in 2 stages which include…
Q: List the sequences of the mRNA molecules transcribed from thefollowing template DNA sequences:a. T G…
A: The sequence of DNA that consists of genetic information is transcribed into RNA. The sequence…
Q: Refer to the Table of the Genetic Code and match the type of mutation to the following codon changes
A: Mutation : A mutation is defined as the changes in the nucleotide sequence. These results in…
Q: Given the following mRNA codons and amino acids, construct a polypeptide from this DNA strand.…
A: Central dogma is the process where in the information stored in nucleic acids is transferred to…
Q: The following diagram illustrates a step in the process of translation. Identify the following…
A: The translation is a process through which a polypeptide chain is synthesized based on the sequence…
Q: What is the name of the nucleotide sequence that helps the 30S ribosomal (small) subunit find the…
A: Translation initiation proceeds through the capture of mRNA by the 30s ribosomal subunit in…
Q: If the template strand of DNA has the sequence 5'AATGCCTATA3', the MRNA sequence that is transcribed…
A: Transcription is the first of several steps in gene expression in which a particular segment of DNA…
Q: Provide the complementary strand and the RNA transcription product for the following DNA template…
A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…
Q: A section of an mRNA has the following nucleotide sequence: ACU UGC AGU GGU GUA For the mRNA…
A:
Q: For each of the following sequences, fill in either the DNA, the MRNA sequence, or the amino acid…
A: The central dogma is referred as the central processing system which includes the transfer of…
Q: Which of the following represents the sequence of an RNA transcript for which the template strand of…
A: The deoxyribonucleic acid (DNA) is the nucleotide sequence that stores the genetic information of an…
Q: Directions: Transcribe the mutated DNA sequence in the space provided. The BOLDED nitrogen bases are…
A: Condon is the trinucleotide nitrogenous bases that codes for specific amino acids and there are in…
Q: Given the following mRNA sequence: 5-AUCCCGUAUGCCCGGGAGCUAGCCCAGC-3 a) Label the first condon, the…
A: Transcription is a process through which the template DNA strand is transcribed into mRNA. mRNA…
Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…
A: The process of producing protein by association of mRNA and ribosomes is called translation. The…
Q: The amino acids, in one-letter symbols and no spaces, coded by the following mRNA sequence is 5’…
A:
Q: Refer to a genetic code table for the question. below is a portion of the template strand of a…
A: The genetic code is a set of three-letter combinations of nucleotides called codons, each of which…
Q: The following diagram illustrates a step in the process of translation. Identify the following…
A: The translation is a process through which the mRNA, transcribed from the template strand of the…
Q: Using the table above and the mRNA transcript AUG-CUC-UAC-AAG-UAG, choose the false statement: XXX…
A: Nucleic acids are involved in various processes in the cell, their main role is the expression of…
Q: How long is the polypeptide produced from the following mRNA transcript?…
A: We can find this answer using a codon chart- 5-UCA UGC UUG GAC UCA AGU CUA CGU GAA U-3' As each mRNA…
Q: For each codon below, give the tRNA anticodon. 3. UUC 4. AUC 5. CCG 6. CGU
A: Anticodons are the three complementary bases present on the tRNA. On the basis of the anticodon, the…
Q: Given the following mRNA sequence, write the peptide sequence that will result from protein…
A: mRNA stands for messenger RNA( Ribonucleic acid). Protein translation is a process of making…
Q: Complete the table below: DNA DNA Complimentary Strand mRNA sequence tRNA sequence Amino…
A: Deoxyribonucleic acid is a molecule composed of two polynucleotide chains that coil around each…
Q: Define and identify the words listed below: CRISPR, codon, anti-codon, transcription
A: Definition: CRISPR: A segment of DNA compiled of short repetitions of base…
Q: What will be the overall anti-codon sequence in tRNA for this mRNA?…
A: Proteins are synthesized from DNA in two step process. These two processes are transcription and…
Q: A Section of a Gene CTA AAA TAG TCT For the DNA sense strand sequence shown above, identify the…
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: Refer to the codon diagram on. Which of the following is a codon that will terminate translation?*
A: A termination codon or a stop codon is a group of three amino acids that is present in the mRNA that…
Q: Using the mRNA codon table below and your knowledge of transcription and translation, complete this…
A: Biological macromolecules are those large molecules that are necessary for the survival and growth…
Q: The MRNA produced when the following sense strand DNA sequence is transcribed is: 5'-…
A: The transcription unit is the segment of DNA that takes part in transcription. It is studied under…
Q: Use the DNA sequence above, list all possible splicing products
A: Splicing, is a form of RNA processing in which a pre- mRNA transcript is transformed into a mRNA.…
Q: An mRNA transcript is listed below and contains both start and termination codons. Assume that the…
A: mRNA(messenger RNA) is a type of RNA(ribonucleic acid) that carries complementary sequence…
Q: Define the term RNAi.
A: Recombinant DNA technology (rDNA technology) is extremely useful for analyzing a species' entire…
Q: A DNA antisense strand contains the following nucleotide base sequence: ACG TTT ATG GGT From this,…
A: DNA has two strands. One of the strands acts as the template strand for the synthesis of mRNA, while…
Q: Using the following DNA template code, which of the following tRNA anticodons would carry the 4th…
A: Introduction DNA:- (Deoxyribonucleic acid) It is a long molecule that contains our unique genetic…
Q: n the given segment, illustrate and indicate the direction of synthesis of: a.) a 5-nucleotide RNA…
A: The replication process initiates with the unwinding of the polynucleotide strand forming a…
Q: Explain the three steps (Codon recognition, peptide bond formation, translocation) in elongation…
A: The translation is the biological process that involves the conversion of the genetic information in…
Q: Use the images to identify the amino acid sequence with the following DNA sequence (hint: transcribe…
A: DNA is transcribed to form mRNA. This mRNA is used as a codon for the formation of amino acid…
Q: A section of an mRNA has the following nucleotide sequence: GCA GCU UGC CAG For the mRNA sequence…
A: In the question, we are given with mRNA sequence. mRNA is a sequence of ribonucleotides synthesized…
Q: The following diagram illustrates a step in the process of translation. Identify the following…
A: The translation of m RNA to peptides occurs in the ribosomes. there are three different sites…
Q: The following segment of DNA codes a protein. The uppercase letters represent Exons, the lowercase…
A: DNA and RNA are the biomolecules that make up the part of our genetic material. DNA is the genetic…
Q: Analyze the following amino acid sequence and write down a potential mRNA sequence from which this…
A: The translation is a process by which ribosomes in the endoplasmic reticulum synthesize proteins…
Q: Which of these choices represents one possible corresponding mRNA sequence that can be transcribed…
A: Transcription is a heterocatalytic action of DNA by means of which RNA is synthesized from specific…
Q: What strand of mRNA would be synthesized from a template DNA strand with the sequence GATGTTTAC…
A: The information from the DNA is transferred to RNA by transcription. The information present in the…
Q: A small section of bacterial mRNA has the following nucleotide sequence: GAC CCG AUG AAC The tRNA…
A: Translation It is the synthesis of proteins from the codons present in the mRNA. Anticodons…
Q: The following diagram illustrates a step in the process of translation. Identify the following…
A: The diagram illustrates the process of elongation of polypeptide chain by adding amino acids one by…
Q: A particular triplet of bases in the template strand of DNA is 5' AGT 3'. The corresponding codon…
A: ANSWER;- 3'UCA 5' Explain;- Transcription is a process of a particular DNA sequence being copied…
Q: If the sequence of an mRNA is GAGUUCACAGUAGGC, the sequence of the template strand of the…
A: DNA strand – DNA is a Deoxyribonucleic acid. It is made up of two polynucleotide chains which are…
Q: A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the…
A: Amino acids are the organic compounds that contain the amino group (–NH2) and carboxyl group(–COOH)…
Q: the coding strand of DNA has the same sequence as the mRNA, except that there are U’s in the mRNA…
A: an delete the 'C' at position 52 Explanation: it is the type of frameshift deletion mutation…
Q: Consider the following portion of mRNA: 3'-CUU-AAA-CGA-GUU-5' What is the primary amino acid…
A: mRNA(messenger RNA) carries the genetic information copied from DNA in the form of a series of…
Refer to Figure 9.7, then translate the following mRNA
5′—UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU—3′
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the first base: 5’ - UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU - 3’Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the second base: 5’ - UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU - 3’For the following DNA bases, give the complementary mRNA code that would be transcribed from these bases: AGCTAATCGGCTACCAGGTACGGATATTCC
- Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’- GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ By in vitro translating the mRNA, you determined that the translated peptide is 15 amino acids long. What is the expected peptide sequence in single letter abbreviations?For the following mRNA sequence (reading from left to right) what will be the amino acid sequence following translation? (Use chart provided) AUGCCAGUUGAAUAA First position U C A UUU UUC UUA UUG CUU CUC CUA CUG U >Phe GUU GUC GUA GUG >Leu >Leu AUU ACU AUC lle ACC AUA ACA AUG Met/start ACG >Val UCU UCC UCA UCG ©2019 Pearson Education, Inc. CCU CCC CCA CCG GCU GCC GCA GCG Second position A >Ser >Pro Thr >Ala UAU UGU U UAC UGC C UAA Stop UGA Stop A UAG Stop UGG Trp G CAU CAC CAA CAG AAU AAC AAA AAG GAU GAC GAA GAG Tyr >His >Gin >Asn >Lys >Asp >Glu CGU CGC CGA CGG AGU AGC AGA AGG G GGU GGC GGA GGG >Cys Arg >Ser >Arg >Gly DOAG SCAG U с А UCA с А G Third position Correct answer not given Met-Val-Tyr-Pro Met-His-Phe-Ala-Arg Pro-Val-Met-Leu-His Met-Pro-Val-GluFor the messenger RNA sequence below, find the beginning of the amino acid coding sequence and translate the sequence using the genetic code provided below. 5' - AAUUAUGGGCAAUAUGCCGGGCcGGUUAAGCG - 3' Second Letter A UGU cys u UGC Phe UCU UU U UUC UUA UAU Tyr Ser UAC UAA UAG Leu UCA Stop UGA Stop UUG UCG Stop UGG Trp CUU CU CAU His CGU c cuc Leu ccc ССА CCG Pro CÁC CAA CAG CGC CGA CGG Arg CUA CUG Gin 1st 3rd letter Ser u letter AUU ACU AAU AAC AAA AAG Asn A AUC AUA AUG lle ACC ACA AGU AGC AGA AGG Thr Lys Arg Met ACG GUU G GUC GUA GUG GCU GAU GAC GAA Asp GGU Val GCC Ala GGC Gly GCA GGA Glu GCG GAG GGG G
- Using the genetic code table provided below, identify the open reading frame in this mRNA sequence, and write out the encoded 9 amino acid long peptide sequence: 5'- CGACAUGCCUAAAAUCAUGCCAUGGAGGGGGUAACCUUUU C A G U UUU Phe UCU Ser UUC Phe UCC Ser UAC UCA Ser UAA UCG Ser UAG UUA Leu Leu G C CUU Leu CUC Leu CCC CUA Leu CUG Leu AUU lle AUC lle AUA lle AUG Met ACG ACU Thr ACC Thr ACA Thr Thr A UAU Tyr UGU Cys Tyr UGC Cys CCU Pro CAU His CGU Arg Pro CAC His Pro CAA Gln CGC Arg CGA Arg CCA CCG Pro CAG Gln CGG Arg GUU Val GCU Ala GAU GUC Val GCC Ala GAC GUA Val GCA Ala GAA GUG Val GCG Ala GAG Stop UGA Stop UGG AAU Asn AAC AAA AAG AGU Asn AGC G Lys Lys Asp Asp Glu Glu Stop A Trp Ser Ser AGA Arg AGG Arg GGU Gly GGC Gly UCAG GGA Gly GGG Gly с U C A G U C A G U C A GUsing the codon table, identify a 5’-3’ sequence of nucleotides in the dna template strand for mRna coding for the polypeptide sequence NH2-PHe-Pro-lys-COOH.Use the following DNA sequence, and write the resulting messenger RNA sequence TACTTTGAATGCGGCCGTATC?
- Indicate the amino acid sequence of the protein encoded by the following mRNA molecule. Use the genetic code table and assume that the very first “AUG” the ribosome encounters will serve as the start codon and specify methionine. 5’-AAUUCAUGCCCAAAUUUGGGGCACGAAGCUUCUUAGGCUAGUCCUAAAAAA-3’Template strand of DNA is: 3’ TACATAACCGGGCCCATATCGGCCATTTGC5’. 2a). Following transcription, what is the total number of codons in the mRNA transcript? 2 b). Where is the start codon located in this mRNA transcript? 2c). Following translation of this mRNA transcript, how many amino acids will the proteincontain and identify the amino acids sequence of this gene from a genetic code table*.*Note= using a genetic code tableGiven the DNA sequence below: 5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’ 3’-TGTACACATGTCCGAAACAGACTTACCGAA-5’ Transcribe the gene. (Write the primary structure of the mRNA that will be produced.)