Using the following DNA template code, which of the following tRNA anticodons would carry the 4th amino acid in the sequence? TAC-AGG-ACA-CCT-TGT-ACT ACU UGU CCU GGA
Q: What is meant by the description "antiparellel" regarding the two strands that make up DNA?
A: DNA is a double stranded molecule which is composed of two long polynucleotide chains. A nucleotide…
Q: 1. Write the complementary coding strand sequence 5' GGG ATG TCA CAC ATA TTT 2. Write the mRNA…
A: The coding strand of DNA is the one that contains the instructions for the gene in concern. The…
Q: What is the DNA template for the RNA sequence 5' UAACGGAGCCUAAUC 3'? O 5' GAUUAGGCUCCGUUA 3' O 5'…
A: In reverse transcription, RNA is "reverse transcribed" into DNA. This process, catalyzed by reverse…
Q: explain the relationship between biological race, ancestry, and socially defined race
A: Classification of organisms is done using morphological, physiological, and molecular data along…
Q: Why does repeated stimulation of the muscle (at maximum stimulus) before it has completely recovered…
A: Muscle contraction is the phenomenon of decreasing in size or shortening or compacting the muscle…
Q: Mathis Wackernagel and his colleagues at the Global FootprintNetwork continue to refine the method…
A: Based on the average income per person, countries have been classified as developed or less…
Q: Why does the plasma membrane of a cell present a barrier to the movement of electrolytes through it?…
A: Introduction - The plasma membrane is a thin lipid bilayer that surrounds and protects the cell's…
Q: Consider the following sentence: "The dog did not eat." Which of the following variations of this…
A: Mutation is a random event. It is responsible for change the sequence of nucleotide in a gene.
Q: A. Identify the following _______________ 1. The hormone that stimulates the mammary gland to…
A: Introduction :- The mammary gland is a highly evolved and specialised organ that exists in pairs on…
Q: at is trinocular microscope
A: A magnifier could be a device that magnifies a picture of a little object, revealing details that…
Q: Why is glucose provided by glycogenolysis in the liver but not in skeletal muscle?
A: Through glycogenolysis process, glycogen broken down into glucose and provide energy. Muscle…
Q: Match the molecules (List 2) with the cell structures in which they are involved (List 1). A cell…
A: The study of cell structure and function is known as cytology. Cytology is also known as cell…
Q: To explain: Why professional gardeners soak their seeds in hydrogen peroxide before planting.
A: Seeds inside each fruit are designed to germinate and grow into a new plant on their own, a process…
Q: malaria
A: Malaria : Malaria is an infection caused by a few plasmodium species which are single celled…
Q: Match the plant parts with the best description. ___ vascular cambium a. ground tissue in…
A: There are different parts of plants that have distinct functions. These parts include seeds, leaves,…
Q: The GAL4 expression system can be used to experimentally induce expression of a gene in a specific…
A: INDUCED EXPRESSION - Inducible expression systems are essential molecular tools for the production…
Q: Mitochondria produce which of the following? A. ATP B. DNA C. RNA D. proteins
A: Answer :- Option A correct, Mitochondria which is produce ATP (adenosine tri phosphate) ATP are…
Q: Why do anisogamous organisms only experience the twofold cost of sex?
A: Anisogamy Aniosgamy is a reporduction process in which the different forms or sizes of male and…
Q: 6. You perform a high throughput DNA sequencing reaction on chromosome number 1 from a newly…
A: a)Arranging the fragments with overlapping sequences on the fragments ends. 2.GGCTATTTCGCCG 4.…
Q: when XRCC2 DNA sequence CTC is changed to CCC (which causes a missense mutation converting Leu to…
A: The mutation is simply defined as a process in which the sequence of DNA of any organism changes.…
Q: Describe the three phases of transcription. Be specific for full credit.
A: Transcription is completed in to three states... 1. Initiation of RNA chain formation 2. Elongation…
Q: . What is meant by a bacterial “colony” or colony-forming unit? 2. Why are colonies that develop on…
A: Since you've asked multiple questions, we're only answering the first three answers for you. If you…
Q: 1. What do ascaris lumbricoides egg look like? 2. How can it infect a person? 3. How to prevent its…
A:
Q: Explain two ways that soil can lose nutrients.
A: * The soil can lose its nutrients by soil erosion, runoff, leaching and burning of crop residues. *…
Q: is studying a cell that has a membrane-bound nucleus and a cell wall but lacks chloroplasts. Which…
A: Depending on cellular constitution and morphology cells can be of two types eukaryotes and…
Q: salient features of guidelines on the disposition of confiscated wildlife species in the Philippines
A: Wildlife species are the animals that are undomesticated and live in an area where they arrive…
Q: d) Identify a passive tissue that could be exposed to continued plastic stress (deformation).…
A: In mechanics, muscles have two primary properties: passive and active. When the muscle is extended…
Q: Patients who are taking herbal remedies or dietary supplements do not need to list them on…
A: False...
Q: An allosteric activator or inhibitor O a. Competes with substrate for enzyme binding O b. Shifts the…
A: Enzymes are the biological catalyst which increases the rate of reaction. The molecules upon which…
Q: Which of the following is not true of the protists? (a) they are unicellular, colonial, coenocytic,…
A: Any unicellular or multicellular creature which is not a mammal, plant, or fungus is referred to as…
Q: In a nucleosome, the DNA is wrapped around ribosomes a thymine dimer polymerase molecules histones
A: Nucleosome Nucleosome is a segment of DNA that wrapped around a protein core.
Q: If we say that a certain STR locus has “high heterozygosity” in the human population, what do we…
A: Short tandem repeat (STR) markers or "core loci" are required for the entry of DNA genotype data…
Q: Name and describe three types of modification that the mRNA undergoes in eukaryotes before the MRNA…
A: Ans - The three types of modifications that mRNA undergoes in eukaryotes before the mRNA is…
Q: Leaves typically have high surface area to volume ratios to maximize the rate of photosynthesis.…
A: Xerophytes have lower or less surface area of leaves than other plants. This adaptation is due…
Q: -In the kennedy class IV, II,I take the support from abutment and most prominent bone should have…
A: There are few important points that should kept in mind . Which are as follows: Applegate's rules…
Q: Describe the ethical issues encompassing germ line gene therapy in 150 words.
A: Introduction Germline gene therapy:- In this therapy DNA is inserted into the reproductive cells…
Q: Strain X. spp. is a rod-shaped, anaerobic, Gram-positive bacterium with peritrichous flagella and…
A: Given information Doubling time 240 minutes = 4 hours. Initial population = 10 cells Final…
Q: Identify the correct group of helminth with sizes of eggs listed from largest to smallest. O…
A: Helminths These are the parasitic worms that can be observed by the naked eye when they are in the…
Q: Which of these statements about taste is true? All bitter-tasting compounds have a similar chemical…
A: Taste buds are peripheral organs of gustation that are primarily found in the tongue epithelium but…
Q: Give an example of a phantom sensation that can be experienced (it can be any one of your senses).
A: The physical process during which our sensory organs those involved with hearing and taste, for…
Q: The ability to taste the compound PTC is controlled by a dominant allele T, while individuals…
A: A trait is a characteristic features that is exhibited by particular individual . As per the…
Q: Oestrogen, follicle-stimulating hormone (FSH) and luteinising hormone (LH) works together to…
A: The endocrine system collaborates with the neurological system to keep the body in a state of…
Q: Cytosine makes up 42% of the nucleotides in a sample of DNA from an organism. The composition of the…
A: Introduction :- Cytosine, along with adenine, guanine, and thymine, is one of the four nucleobases…
Q: PROTEINS NUCLEIC ACIDS
A: Proteins serve a variety of purposes, such functioning as enzymes and hormones, regulating fluid and…
Q: To explain: In terms of natural selection the reason why no new puriri trees in New Zealand are…
A: The Keruru birds are native pigeons found throughout New Zealand. Many trees rely solely on these…
Q: Termites digest wood with the help of an enzyme secreted by the- (A) Salivary glands (B) Cells in…
A: Termites are insects that feed on wood. They get nutrients from cellulose found in wood.
Q: Root hairs____ . a. conduct water from cortex to aboveground shoots b. increase the root’s surface…
A: Roots are the underground structures of plants.
Q: Explain why the yield of ATP is high in oxidative phosphorylation as compared to other stages.
A: Answer :- Adenosine 5′-triphosphate, abbreviated as ATP and generally written without the 5′-, is a…
Q: Use the genetic code table. Which amino acid is coded for by only one codon sequence? Second…
A: Ans is.. methionine
Q: Are all foods created equal in terms of their effect on the environment? Explain.
A: The authors believe that items that are thought to be bad for your health, like red meat, are also…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:If the genetic code uses triplets, how many different amino acids can be coded by a repeating RNA polymer composed of UA and UC (UAUCUAUCUAUC ...)? a. one b. two c. three d. four e. fiveUsing the codon table, identify a 5’-3’ sequence of nucleotides in the dna template strand for mRna coding for the polypeptide sequence NH2-PHe-Pro-lys-COOH.
- Give the mRNA and amino acid sequence from this DNA strand: TACATACCTCGGCTTTGGCTGAAAGGTACTTATAATGCThe sequence is read from left to right. The table below shows which mRNA codons code for each type of amino acid. UUA - Leu | UCA - Ser UAA - Stop | UGA-Stop UUU - Phe | UCU - Ser UAU- Tyr UGU- Cys CỦA - Leu CCA - Pro CAA - Gln | CGA - ArgA UUG - Leu UCG - Ser| UAG-Stop UGG- TrpG A DNA sequence before and after replication IS SHO Second mRNA base G DNA sequence before replication: UUC - Phe UCC -Ser UAC U TACCTAGCT Туг UGC Cys DNA sequence after replication: A TACCTCGCT Leu CCU - Pro CAU - His CGU. CUU Arg U - Pro CAC - His CGC- ArgC CUC - Leu ССС Pro CAG - Gln | CGG - Arg G CUG - Leu CCG Thr AAU - Asn AGU - Ser Ile ACC - Thr AAC- Asn AGC Ile ACU AUU AUC Ser Lys AGA Arg Thr AAG - Lys AGG - AUA Ile ACA - Thr AAA- A mutation occurred in the DNA sequence during replication. Which of the following, A-D, Arg Asp GGU-Gly AUG - Met ACG GUU - Val GCU - Ala GAU - GỤC - Val GCC - Ala GAC - Asp GGC - Gly Val GCA -Ala GAA - Glu GGA - Gly Val GCG - Ala GAG-Glu GGG-Glv describes the result of the…Use the codon chart to determine the following RNA strand in amino acids (Remember to write it the same way the strand is): ACA-AGG-UUA-UGA second letter C A UAU Tyr U UUU UCU UGU Phe Cys UUC UCC UAC UGC C Ser UAA stop | UGA stop| A UAG stop UGG Trp UUA UCA UUG Le UCG CUU CCU CAU CGU His CUC ССС CAC CGC Leu Pro Arg CUA ССА САА CGA Gln СCG CAG CGG CUG AGU AAU Asn AUU ACU Ser AGC S AGA Arg AAC AUC } lle A AUA АСC Thr AAA Lys АСА AUG Met ACG AAG AGG GUU GCU GAU GGU Asp GAC GGC Gly GGA GCC GUC Val Ala GAA GAG } GUA GCA Glu GGG GUG GCG Your answer first letter ACUCAGUCAGUCAG third letter
- Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the second base: 5’ - UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU - 3’Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the first base: 5’ - UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU - 3’Given the following protein, which of the following sequences of TEMPLATE strand DNA would code for it? Pay attention to the polarity of the polypeptide and the strands of DNA that you choose. Use the codon chart to the right. AUG = met AAA = lys GCU = ala | CUU = leu ACU = thr -lys - thr - ala - leu - met (amino end) 5' TAC GAA CGA TGA TTT TAC ATT 3' 5' ATG CTT GCT ACT AAA ATG TAA 3' (carboxyl end) met 5' TAC TTT TGA CGA GAA TAC ATT 3¹' 3' TAC TTT TGA CGA GAA TAC ATT 5¹ 5' ATG AAA ACT GCT CTT ATG TAA 3¹ 3 TAC GAA CGA TGA TTT TAC ATT 5'
- FIRST BASE UUU- UUC UUA UUG U CUU- CUC -Phe -Leu DNA Sequence tRNA Sequence (anticodon) -Leu CUA CUG AUU- ACU AUC lle ACC AUA ACA Met or AUG Start ACG- GUU GUC GUA GUG mRNA Sequence (codon) AMINO ACID Sequence SECOND BASE C -Val UCU- UCC UCA UCG- CCU CCC CCA CCG GCU GCC GCA GCG Ser -Pro Thr Ala AAG GAU UAU Cys UAC UAA Stop UGA Stop UAG Stop UGG Trp CAU- CGU -His CAC CGC CAA CGA -Gin CAG CGG AAU- AGU- AAC- AGC AAA- AGA AGG GGU- ASP GGC GGA GGG GAC- GAA GAG UGU- Tyr UGC- Asn Lys G Glu Arg 2 1. In your bag is a specific DNA sequence. 2. Copy that sequence in the box below labeled DNA sequence 3. Transcribe the sequence in the appropriate box. 30 Ser 4. Determine the appropriate anticodon sequence. 5. Translate the appropriate sequence into an amino acid sequence using the codon chart above 6. Using the contents of the bag, create your protein. Arg Gly THIRD BASEA segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: GGCTAGCTGCTTCCTTGGGGA CCGATCGACGAAGGAACCCCT Note out the mRNA sequence generated by the template strant to produce that polypeptide chain Label each stran with its correct polarity (5' and 3' ends on each strand)If DNA segments changes from GCATAG to GCATGG, this is a: MRNA Codon/Amino Acid Chart First Base Second Base Third Base A G UUU1 Phenylalanine UCUT UAUT FTyrosine (Tyr) UAC UGU, U FCysteine (Cys) UGCJ UUCJ (Phe) UCC Serine (Ser) UCA U UGA - Stop A UUA1 FLeucine (Leu) UUG- UAA1 FStop UAGJ UCG- UGG - Tryptophan (Trp) G CUU CAU1 CCU1 CGUT Histidine (His) CAC- CUC CCC Proline (Pro) CCA CGC FLeucine (Leu) CUA FArginine (Arg) CGA CAA1 Glutamine A CAGJ (Glu) CGG- CUG- CCG- ACU AAUJ Asparagine AUUT AGUT FSerine (Ser) AGC- U AUC FIsoleucine (lle) ACC AACJ(Asn) Threonine A AUA- (Thr) AAA1 FLysine (Lys) AAG- АСА AGA, FArginine (Arg) AGG- A Start Methionine AUG- (Met) ACG- G GUU GCU, GAU1 Aspartic Acid GGU U GAÇJ(Asp) GUC Fvaline (Val) GUA GCC GGC G Alanine (Ala) GCA Glycine (Gly) A GAAJ Glutamic Acid GGA GAG- (Glu) GUG- GCG- GGG- G
