What is the lagging strand sequence if the leading strand of DNA is TTA CCG ATC GAA?How many amino acids can be identified if the coded mRNA sequence is GCAUUACAUGGCGGA Q3M4 DNA AND PROTEIN S Xe/1FAIPQLSDP_g5B-629FSHNpGnTMiEppLS4A71zBd4vcUBqNUILubXONw/formResponse2. What is the lagging strand sequence if the leading strand sequence ofDNA is TTA CCG ATC GAA? *O UAU CCG AUG CUATCG CCC AUG CUAO GCG CCG ATG GUAO AAT GGC TAG CTT3. How many amino acids can be identified if the coded mRNA sequenceis GCAUUACAUGGCGGA ? *O 6O 4LeadpleF4F5F6F7F8F9

Name: What is the lagging strand sequence if the leading strand of DNA is TT
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: What is the lagging strand sequence if the leading strand of DNA is TTA CCG ATC GAA?How many amino acids can be identified if the coded mRNA sequence is GCAUUACAUGGCGGA Q3M4 DNA AND PROTEIN S Xe/1FAIPQLSDP_g5B-629FSHNpGnTMiEppLS4A71zBd4vcUBqNUILubXON

Introduction:- The leading strand is a strand of nascent DNA that is generated in the same direction…

Science

Biology

Q3M4 DNA AND PROTEIN S X e/1FAIPQLSDP_g5B-629FSHNpGnTMiEppLS4A71zBd4vcUBqNUILubXONw/formRespons 2. What is the lagging strand sequence if the leading strand sequence DNA is TTA CCG ATC GAA? * O UAU CCG AUG CUA O TCG CCC AUG CUA O GCG CCG ATG GUA O AAT GGC TAG CTT

Q3M4 DNA AND PROTEIN S X e/1FAIPQLSDP_g5B-629FSHNpGnTMiEppLS4A71zBd4vcUBqNUILubXONw/formRespons 2. What is the lagging strand sequence if the leading strand sequence DNA is TTA CCG ATC GAA? * O UAU CCG AUG CUA O TCG CCC AUG CUA O GCG CCG ATG GUA O AAT GGC TAG CTT

Anatomy & Physiology

1st Edition

ISBN:9781938168130

Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble

Publisher:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble

Chapter3: The Cellular Level Of Organization

Section: Chapter Questions

Problem 17RQ: Which of the following sequences on a DNA molecule would be complementary to GCTTATAT? TAGGCGCG...

See similar textbooks

Similar questions

Which of the following sequences on a DNA molecule would be complementary to GCTTATAT? TAGGCGCG ATCCGCGC CGAATATA TGCCTCTC
EcoRI --- 5' G - AATTC 3' 5' AGAATTCCGACGTATTAGAATTCTTAT CCGCCGCCGGAATTCT CATCA 3' 3' TCTTAAGGCTGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5' Number of pieces of DNA , and type of fragment .
BM4_DNA AND PROTEIN S X /1FAIPQLSDP_g5B-629FSHNpGnTMIEppLS4A71zBd4vcUBqNUILubXONw/formResponse 4. What is the nitrogen base pair of Adenine in transcription? O Cytosine O Uracil O guanine O thymine 5. The central dogma of Molecular Biology states that There are four nitrogen bases in DNA, two purines (adenine and guanine) and two pyrimidines (cytosine and thymine). Which process is not included in the central dogma? duplication transcription translation O translocation Leadple
11.5 A A Aa-AE-E-¹5- U - abe X₂ X² A-ay-A- Font Ulla Unigriffin DNA: mRNA: amino acids: traits: DNA: traits: mRNA: amino acids: · DNA: mRNA: to search #N O E Et CE- Paragraph $ 15 Ser 1. CAT AGG GAG | CAA GGG TGA CTT TTT | AAT AAT GAC GGG | A E ALT | CAA TTG TTA CGG | AAA AGA CCC | GCC ATA ACA TTT | % STP | CAC CGT CGA | GTA GTA | AGA GGG CAT | TTG TAA GGA GGG GGG TGT | 16 AaBbCcDc AaBbCcl AaBbCcL Aa BbCcDc 1 Normal 1 Body Text 1 List Para... 1 No Spac... W] Tyr 17 Val & 7 Gly E CO OM no num lk T Aa Bb Cc 1 Table Pa (p)) Styles 12 P
40 Shown below is the antisense strand of DNA. What is the amino acid sequence that corresponds to this code? 5' AAAGCATACCGG 3' Second letter G. UUU Phe UCU UAU) Tyr UGC Cys UGU UUC UCC UAC Ser UAA Stop UGA Stop A UAG Stop UGG Trp UUA UCA UUG Leu UG CAU His CGU CGC CGA CGG CU CUU CUC CUA CUG CAC Pro Leu Arg CCA CAA) Gin CCG CAG AAU AUU AUC lle AUA AUG Met ACG ACU AGU AAC Asn AGC Ser ACC ACA Thr AAA1 AGA AAG Lys AGG Arg GAU) Asp GGC GAC Ala GAA GGU GUU GUC GUA Val GCU GCC Gly GCA GGA Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a PRO-VAL-SER-PHE PHE-ARG-MET-ALA GLY-HIS THR-LYS d LYS-ALA-TYR-ARG First letter Third letter
48 Second letter If any single nucleotide is deleted from the DNA sequence shown below, what type of mutation is this? UUU U UUC UUA UCU Phe UCC UAU UGU Cys ANTISENSE 5' GGACCCTAT3' UAC Tyr UGC UAA Stop UGA Stop UAG Stop UGG Trp Ser UCA Leu UUGL" UCG CUU CU CAU) His CAC) CGU CGC CGA Arg CUC C Leu Pro CAA1 Gin CAG) CUA CCA CUG CG CGG AAU AAC Asn AGC AAA AAG Lys AGG Arg AUU ACU AGU Ser AUC lle ACC Thr AUA ACA AGA AUG Met ACG GCU GCC GUU GAU] GGU GUC Val GAC Asp GGC Ala Gly GUA GCA GAA GGA Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a FRAMESHIFT SILENT NONSENSE MISSENSE Third letter First letter
This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' (i) Draw the structure of hairpin loop that will be formed during the end of transcription. (ii) Describe the function of the hairpin loop during transcription.
Name: Date: 2. The sequence of a fragment of one strand of DNA is AATTGCATATACGGGAAATACGACCGG. Transcribe this s sequence into MRNA. er bns eldst eboo oi ebitqeqylog erlt to noihiog eri qu elsm bluow tsri abios onime Jlaw as ye s 1ot noitem atelomet AHG 3. The following MRNA ştrand is being used to asemble a polyp
E D ot OH ON O Replication R SORO Transcription ORNA processing Translation Gene expression 657 F Q Search % T G LOCLE Y F7 & 87 F8 U 99+ 8 F9 53879 10 F10 O 2 H J K L CV BN MO < F12
UCA CAG AAA CUG How many amino acids does the mRNA strand above code for?
5' UGG CAA UCC UAC GAU 3' - 1. Here is the MRNA sequence from a section of a gene (it is the middle of the sequence, so it has no AUG). What is the template sequence of this gene? - 2. Are any of these codons in the MRNA non-degenerate? If so, indicate which one. e 3. 4 a) Translate this mRNA section. Give the 3 letter codes for the amino acids. b) Indicate on the peptide which is the C terminus and which is the N terminus. e 4. Is it possible for a single base pair substitution to cause a truncation in this peptide? If so, e explain how. e 5. Write out the sequence of the anticodon in the tRNA that would bind to the fourth codon in the e MRNA. e 6. Write out a possible miRNA that could regulate the expression of this gene
3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Make vertical lines between codons to make this assignment easier to do. Which strand is the template strand? The first strand is the template strand as it going 3-5 Copy the template strand in mRNA. Label the 5’ and 3’ ends. 5' AUG UUA CCC GCU GCG CGA AGC AAA GUC UAA 3” Write out the amino acid (you can use the short form) that this protein would be made of (keep in mind proteins are usually a minimum of 50 proteins. Met-Leu-Pro-Ala-Ala-Arg-Ser-Lys-Val What do you notice about the mRNA strand compared to the non template strand of DNA? 2. What amino acid does the second codon code for on the DNA template strand? ______Assume the 6th amino acid in the strand is changed from a T to a C. What amino acid does it code for now? _______ What type of mutation is this? 3. Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would…