Q: Which of the following strands of DNA always has the same sequence (except T-> U) as its…
A: In genetics,a sense strand or coding strand is the segment within double stranded DNA which carries…
Q: A DNA antisense strand contains the following nucleotide base sequence: ACG TTT ATG GGT From this,…
A: Answer: Central Dogma : It is the complete process of replication of DNA, transcription of DNA to…
Q: On diagram A: label the 3’ and 5’ end. is this strand more likely DNA or RNA. Why? On diagram…
A: The DNA and RNA both are nucleic acids that are composed of nucleotides. The nucleotides are…
Q: . The table opposite shows the standard (coding strand) DNA inlet codes for the 20 amino acids…
A: Given , the coding strand is 5'-CATCCAAATTGTTGCCCG-3' THE TEMPLATE STRAND WILL BE ,…
Q: DNA Sense G C A strand DNA Antisense TAC T strand AUG MRNA codon U TRNA anticodon Amino acid…
A: Transcription Cellular process in which RNA is synthesized using DNA as a template known as…
Q: Which of the following statements is false of ligase? Ligase is specific to leading strand…
A: DNA ligase is a specific type of enzyme, that facilitates the joining of DNA strands together by…
Q: The following is a section of DNA removed from a cell nucleus: 5'…
A: The basic physical and functional unit of heredity is the gene. DNA is the material that makes up…
Q: Okazaki fragments O are short DNA fragments are intermediates in DNA replication begin with a short…
A: Okazaki fragments are a short sequence of DNA nucleotides. The answer is given in step 2.
Q: of a gene are (is) used as the template for RNA synthesis. a sense strand antisense strand both…
A: The process of synthesis of a Daughter stand from the parental DNA strand is called replication.…
Q: Shown below is the " sense" strand of DNA. Second letter U What is the amino acid sequence that…
A: Introduction :- Deoxyribonucleic acid (DNA) is a molecule made up of two polynucleotide chains that…
Q: What kind of DNA damage is depicted in this picture: HN H20 HO ar g O strand breakage O base…
A: DNA damage is a change in the basic structure of DNA that is not itself replicated when the DNA is…
Q: Translate this DNA sequence using Genetic Code 5' - ATG GGG cCC GTC CAT CCG TAC GCC GGA ATT ATA - 3'…
A: DNA is transcribed into mRNA through the process of transcription. mRNA is then translated into…
Q: Which of the following enzyme is responsible for making a DNA copy from RNA?a) Reverse…
A: Transcription: It is a process in which RNA is synthesized by RNA polymerase using DNA as…
Q: This is the non-template strand of a double stranded DNA. RNA is transcribed from using one of the…
A: DNA serves as the genetic material and carries genetic information from one generation to another.…
Q: Send A PEETRAS O
A: Transcription is the process of formation of RNA from the DNA.The transcription process takes place…
Q: How many amino acids does the mRNA strand above code for?
A: 1. 4 amino acids does the above mRNA strand code have -
Q: DNA Repiica TCC cca GTA GAC ATT TTA TTG CCA GTC AAT AAC GcC TTT TTC CAC AGA TAT ACA тот MRNA Strand…
A: DNA is converted into mRNA by transcription. mRNA has the codons, complementary sequence of the DNA…
Q: When a geneticist or microbiologist uses ligase, what is the ligase being used for covalently…
A: DNA ligase is an enzyme that is used to join fragments of DNA by catalyzing the formation of…
Q: The following image shows how DNA can be damaged by UV light. In this reaction, UV light promotes…
A: Mutation: It is a heritable change in the genetic material of an organisms that give rise to…
Q: DNA coding strand ATG GGA ATT CGC can not get this what the sequence of the complementary template…
A: The DNA strand which functions as template for RNA synthesis is known as template strand, minus…
Q: Which of the following is Not correct about Okazaki fragments? O they are synthesized by addition of…
A: option 2 is correct because there are two strands in DNA replication.one is leading strand and the…
Q: Which of the following is synthesized from a DNA template? (Select one) a. Transducer RNA b.…
A: The short stretch of DNA that serves as a functional unit of heredity is called the gene. The…
Q: will synthesize the in short pieces that are linked together by the enzyme , but the is made…
A: Deoxyribose nucleic acid (DNA) is the genetic material for almost all living organisms. DNA is a…
Q: The sequence of mRNA made using the DNA double helix shown below is (Select ] The sequence of…
A: Introduction Protein synthesis is a two step process. In the first step, a molecule of mRNA is…
Q: For a double stranded coding region DNA transcribed from left to right and whose top strand is…
A: There are two strands of DNA. One strand goes from 5' to 3' and the other strand goes from 3' to 5'.…
Q: Which strand was used for the following old amino acid. strand 3 "ATGGAATGTTTACCCGTATTATACGGATAGACG…
A: By the process of transcription mRNA is produced from the DNA. the transcription process occurs…
Q: An E. coli replication fork is shown in Figure 2.2. III 3' IV 5 II Figure 2.2 (i) Identify the…
A: The nucleic acid polymer has nucleotide as its monomeric unit. The synthesis of nucleotides is an…
Q: Table 8.2: Transcription and translation of the first 7 codons in the B-globin chain of hemoglobin.…
A: Change in the DNA sequence can causes alternation of the amino acid sequence. This can causes an…
Q: What is an advantage and a disadvantage of this repair system?
A: DNA is the genetic material that carries genetic information in the form of coded nucleotide…
Q: Assume that you are a RNA polymerase. Which strand is the template strand?…
A: Second one is the template strand for RNA polymerase.
Q: dna stored at physiological ph is negative charge single strand positive charge unchanged…
A: The DNA deoxyribonucleic acid is the genetic material in almost all organisms except in case of few…
Q: Define the following terms:a. DNAb. RNAc. double helixd. genomee. transcription
A: DNA : DNA is deoxyribonucleic acid. It is a long molecule which is made up of nucleotides .…
Q: 5’-GTCGTATAGTGA-3’ 3’-CAGCATATCACT-5’ if this is the dna sequence is the RNA sequence this…
A: Transcription is the process of the synthesis of mRNA from a DNA. This process occurs in the nucleus…
Q: Given the double-stranded DNA molecule shown below, what is the sequence of the mRNA corresponding…
A: Given information: Coding strand 5' TATGAAATTTAAATTT 3' Template strand 5' ATACTTTAAATTTAAA 3'
Q: The line below depicts a DNA segment from a eukaryote. In this case, only the top, coding strand, is…
A: Eukaryotic DNA is enclosed within a double membrane bound nucleus. In eukaryotic transcription,…
Q: Which kind of chemical damage is depicted in this picture: 2-OH strand breakage base deletion base…
A: Genome is a dynamic substance in nature. There are many physical and chemical agents which has the…
Q: A cytosine deamination occurs in the top strand of the following DNA duplex 5'-gATTACA-3'…
A: DNA (deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…
Q: DNA RNA ANTICODON AMINO ACID SENSE strand ANTISENSE CODON strand ATG TẠC CAT GTA АСА TGT TCG AGC CGC…
A: The data that'd be accessible on RNA is found on the sense strand, which is referred to as the…
Q: What enzyme replaces the RNA primers on the Okazaki fragments on the lagging strand? DNA Pol II
A: DNA replication is the process by which DNA duplicates itself. One of the most important feature of…
Q: Using the table of genetic code, choose the CORRECT protein sequence that will be produced from the…
A: Genetic code is a triplet code called a codon. There are 64 codon out of which three codon do not…
Q: Which kind of chemical damage is depicted in this picture: IN H,N NH3 SARA NH DNA DNA Selar Base…
A: Base deletion is a type of mutation in which a base is deleted from DNA. Strand breakage is a…
Q: What is it? Leading chain Ligase procedure Replication fork T structure that may participate in…
A: DNA replication is the process by which the genomic DNA is copied in cells. In this process by which…
Q: True or false double strand rna is synthesized using taq polymerase. plasmids are linear…
A: In biotechnology different techniques has been developed for the synthesis and identification of…
Q: Give me nucleotide sequence with pairing. Like this ATC TCA TGA GCC TAG AGT ACT. CGG
A: The nucleotides are the building blocks of nucleic acids. The nucleotides are formed of a…
Q: One strand of DNA has the base sequence as shown below. Complete the transcription and translation…
A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…
Q: From the sequence given below, provide the ff: 5 AT G Cс с A С A GT G GA с стт т сс т G A 3' 1. DNA…
A: DNA replication is a process in which DNA itself serves as template for synthesis of DNA . It…
Q: A single (+) strand of DNA (base composition: A, 21%; G, 29%; C, 29%; T, 21%) is replicated by DNA…
A: DNA is the genetic material which stores all the biological information. It helps transmitting…
Q: What kind of DNA damage is depicted in this picture: H2D но. H.N Bar strand breakage O base deletion…
A: DNA damage is defined as the deterioration of the bases or the chemical addition that modifies the…
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' (i) Draw the structure of hairpin loop that will be formed during the end of transcription. (ii) Describe the function of the hairpin loop during transcription.Genetic Code-Reference Second Letter First Letter C Third Letter UAU] UACS **UAA Stop UGU] Cys UGC U UUU Phe UUC UCU Туг UCC U Ser UUA) Leu UUG **UGA Stop UGG Trp UCA UCG **UAG Stop CUU CCU CAU) CGU His CACJ CAA) CUC CCC CGC Leu Pro Arg CUA ССА CGA A Gln CUG CCG CAGJ CGG AAU] AGUSer U AUU ACU AACAsn AAA Lys AUC Ile ACC AGC C Thr AGA] Arg AUA ACА AAGJLYS GAU] GACASP *AUG Met/Start ACG AGG U GUU GCU GGU Asp GUC GCC GGC Val Ala Gly GAA) Glu GAGJ GUA GCA GGA GUG GCG GGG48 Second letter If any single nucleotide is deleted from the DNA sequence shown below, what type of mutation is this? UUU U UUC UUA UCU Phe UCC UAU UGU Cys ANTISENSE 5' GGACCCTAT3' UAC Tyr UGC UAA Stop UGA Stop UAG Stop UGG Trp Ser UCA Leu UUGL" UCG CUU CU CAU) His CAC) CGU CGC CGA Arg CUC C Leu Pro CAA1 Gin CAG) CUA CCA CUG CG CGG AAU AAC Asn AGC AAA AAG Lys AGG Arg AUU ACU AGU Ser AUC lle ACC Thr AUA ACA AGA AUG Met ACG GCU GCC GUU GAU] GGU GUC Val GAC Asp GGC Ala Gly GUA GCA GAA GGA Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a FRAMESHIFT SILENT NONSENSE MISSENSE Third letter First letter
- BM4_DNA AND PROTEIN S X /1FAIPQLSDP_g5B-629FSHNpGnTMIEppLS4A71zBd4vcUBqNUILubXONw/formResponse 4. What is the nitrogen base pair of Adenine in transcription? O Cytosine O Uracil O guanine O thymine 5. The central dogma of Molecular Biology states that There are four nitrogen bases in DNA, two purines (adenine and guanine) and two pyrimidines (cytosine and thymine). Which process is not included in the central dogma? duplication transcription translation O translocation LeadpleMutated DNA Sequence #3 T A C A C C T T A G C G A C G A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ________________________________ Mutated DNA Sequence #4 T A C A C C T T G G C G A C T A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ______________________________Mutated DNA Sequence #2 T A C G A C C T T G G C G A C G A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ________________________________
- If the sequence of amino acids encoded by a strand of DNA is serine-alanine-lysine-leucine, what is the order of bases in the sense strand of DNA? Use the codon chart below to help you: second letter A G UAU Tyr UGU UUU UCU Phe Сys UUC UCC UAC UGC Ser UAA stop |UGA stop | A UAG stop UGG Trp UUA UCA UUG Leu G UCG CUU CCU CAU CGU His CUC ССС САС CGC Leu Pro Arg CUA ССА САА CGA Gln CUG CCG CAG CGG AUU ACU AAU AGU Asn Ser AUC le A AUA AAC AAA AGC AGA Arg АСС Thr ACA AUG Met | ACG AAG Lys AGG GUU GCU GAU GGU Asp GUC Val GUA GAC S GAA Glu GCC GGC Gly GGA Ala GCA GUG J GCG GAG GGG) O 3' AGACGTTTCAAT 5' O 3' UGUGCAAAGUUA 5' О 5 TGTGCTTТCТТА 3' first letter UCAG UCAG PCAG third letterOriginal DNA DNA Protein TACGCTATGAGC Methionine-Arginine-Tyrosine-Serine Mutation #1 DNA What type of mutation occurred? substitution insertion duplication deletion TACTCTATGAGCFirst Letter A G U с 22. Using the provided "Genetic Code-Reference" answer the following question. Based on the following DNA template strand, write out the amino acid chain produced. 23. Consider the following mRNA base codon sequence 5'-AUC-GAA-3' and the provided "Genetic Code-Reference". Genetic Code-Reference UUU UUC UUA UUG CUU CUC CUA CUG (mutated or silent) (mutated or silent) b. Briefly explain your reasoning for each. (be sure to include both parts) AULLY AUU a. Label which of the following would result in a mutated amino acid sequence or a silent mutation. (May help to first determine the original amino acid sequence, then compare to mutations) U Phe mRNA codon sequence: anticodon sequence: amino acid sequence: Leu Leu 5'-AUA-GAA-3' Val 5'- AUC-GAC-3' AUC Ille AUA AUAJ *AUG Met/Start GUU GUC GUA GUG UCU UCC UCA UCG) CCU) CCC ccc CCA 000 CCG ACU ACU ACC ACA ACG, C GCU GCC GCA GCG Second Letter Ser Pro Thr 3'-CAA-GTC-TGT-5' Ala UAU UAC) Tyr Туг A **UAA Stop UAG Stop CAU] CACJ…
- For the messenger RNA sequence below, find the beginning of the amino acid coding sequence and translate the sequence using the genetic code provided below. 5' - AAUUAUGGGCAAUAUGCCGGGCcGGUUAAGCG - 3' Second Letter A UGU cys u UGC Phe UCU UU U UUC UUA UAU Tyr Ser UAC UAA UAG Leu UCA Stop UGA Stop UUG UCG Stop UGG Trp CUU CU CAU His CGU c cuc Leu ccc ССА CCG Pro CÁC CAA CAG CGC CGA CGG Arg CUA CUG Gin 1st 3rd letter Ser u letter AUU ACU AAU AAC AAA AAG Asn A AUC AUA AUG lle ACC ACA AGU AGC AGA AGG Thr Lys Arg Met ACG GUU G GUC GUA GUG GCU GAU GAC GAA Asp GGU Val GCC Ala GGC Gly GCA GGA Glu GCG GAG GGG GmRNA Codon Chart: Second letter с บบบ UCU UAU Phe UUC UCC U Ser UAC Tyr UGU UGC Cys UUA UCA Leu UAA Stop UGA Stop A UUG UCG UAG Stop UGG Trp CUU CCU CAU CGU CUC CCC His CAC Leu Pro CUA CCA CAA CGA Arg Gin CUG CCG CAG CGG AUU ACU AAU AUC lle ACC AAC AGU ]Asn Ser AGC A Thr AUA ACA AAA Lys AGA Arg AUG Met ACG AGG GUU GCU GAU GUC GCC Val GAC Asp GGU GGC Ala GUA GCA GUG GCG GAG GGG GAA Glu GGA Gly Amino Acid 3-Letter Codes Name of Amino Name of Amino 3-Letter Code 3-Letter Code Acid Acid Alanine Ala Leucine Leu Arginine Arg Lysine Lys Asparagine sex Methionine Met (start) Aspartic Acid Asp Phenylalanine ebe Cysteine Cve Proline Pro Glutamic Acid Glu Serine Ser Glutamine Gln Threonine Glycine GLK Tryptophan JAR Histidine His Tyrosine Tyr Isoleucine lle Valine Val Exercise: Transcription & Translation 1. Choose 3 DNA Templates. 2. Write the mRNA sequence divided into 3 letter codons. 3. Write the sequence of amino acids. 4. Find the corresponding amino acid sequence and include the letter of…I have a question I'm not sure about here it is...... If a short sequence of DNA is 5’-CGTAATCGGATC-3’, its complementary RNA strand is The answers given are: 5’- GCAUUAGCCUAG -3’. 5’- GAUCCGAUUACG - 3’. 5’-GATCCGATTACG - 3’. 5’-GCATTAGCCTAG - 3’.