`NH HO `NH2 ОН ОН
Q: What is tne value of VX P in tne Table 6? Table 6. Data on Volume-Pressure Relationship Trial volume…
A: Answer- The value of V*P is given below- Trial Volume (L) Pressure (atm)…
Q: 6. Which of the following is an example for broad substrate specificity? a) Chymotrypsin hydrolyzing…
A: Carbohydrates or carbs are maconutrient consisting of Carbon, hydrogen and oxygen atoms. In nature…
Q: What Type of guard column, separation column, and suppressor used for anion- exchange chromatography
A: In the anion-exchange chromatography, the process of separation occurs which is based on the charges…
Q: 1.Antibiotics that are active against G= and G- organisms such as Blank 1, Blank 2, and Blank 3…
A: Hi! Thank you for the question. We are authorized to answer two subparts at a time, since you have…
Q: (a) Lock and key model versus induced fit model of enzyme activity.
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: How many molecules of water are produced by the electron transport chain during the complete aerobic…
A: Stearate is saturated fatty acids and C18:0, 18 carbon atoms. It is metabolized by beta oxidation in…
Q: c. Ribulose 5-phosphate levels would decrease. d. NADH to NAD+ ratios would decrease. e.…
A: In the RBC's of the patients certain changes are observed. Ribulose 5 Phosphate levels would…
Q: D. Lactate
A: Glycolysis is the phenomenon in which sequence of reactions converted glucose to pyruvate and…
Q: 4. During a lunch at a MeDonald's outlet, an office employee received about 350 g of carbohydrates…
A: "Since you have asked multiple questions, we will solve the first three subparts of the question for…
Q: II. GENERAL INSTRUCTIONS Answer the following items. 1. Give an example of a catalyst and its…
A: Tri carboxylic acid cycle or the citric acid cycle, TCA cycle or the Krebs cycle is a series of…
Q: 3- Planning, implementation and evaluation
A: Health Sector is the most important sector of today's world which includes which includes hospitals,…
Q: Why people with PK deficiency may tolerate a lower hemoglobin level than people with other types of…
A: Pyruvate kinase deficiency (PKD) is the most prevalent congenital glycolysis enzymatic abnormality…
Q: J A positive result for Fohl's test is the formation of a black precipitate in the form of lead. O A…
A: Fohl's Tests - This test is performed to detect the presence of amino acid which containing sulfur.…
Q: From an extract of human cell growing in tissue culture, A fibrous substance was obtained. How would…
A: Introduction: The primary structure of both DNA and RNA are similar. Each consists of a…
Q: Can you please briefly describe the reaction mechanism that permits the detection of reducing sugars…
A: Fehling's reagent is a reagent commonly employed in differentiation of water soluble carbohydrates…
Q: 3. sports amp. Intensively pool for 120 minutes two hours after each meal. What metabolic changes of…
A: Hi! Thank you for the question, as per the honor code, we are allowed to answer the first…
Q: Explain the difference between saturated and unsaturated fats.
A: The chemistry of the triacylglycerols determine their physical properties.
Q: 5. What molecules are missing from boxes in the gluconeogenesis reaction shown below 203PO- OPO,2…
A: H2O
Q: 3. Do enzymes act better under acidic or alkaline pHs?
A: Most favored pH value - the pH point where the enzyme has most activity - is known as the optimum…
Q: In one (1) sentence point out a key functional similarity and difference in each of the pair of…
A: Aminoacids are the building blocks of proteins that are classified as acidic , basic and Amino acids…
Q: DNA Leading strand: 5' AAA ATA | CGC TTT|TTA ATT| AAC CCC GGG 3' A | B| C I D Exons: A, C, D…
A: The Central Dogma of Molecular Biology states that the genetic information stored in DNA is first…
Q: Which of the following processes generates the most ATP? (Account for the no. of ATP) a. ) Citric…
A: The human body is a complex system that requires energy to operate effectively. At the cellular…
Q: 1. Which of the following is not true for the specificity of enzyme action? a) Specificity refers to…
A: Enzymes are proteins that assist the bodies speed up chemical processes. Enzymes are necessary for…
Q: DNA ligases cannot join the sticky ends of two DNA fragments. True False
A: The DNA ligases are used in the process of cloning in which pieces of DNA having matching ends are…
Q: 1. Write the ten reactions of the glycolytic pathway, naming all enzymes and providing the…
A: Glycolysis is a process in which one mole of glucose is partially oxidized into the two moles of…
Q: 4. What is a "partially hydrogenated vegetable oil"?
A: Oils are nonpolar, unsaturated lipids that are liquid at room temperature. they are hydrophobic…
Q: a) Lock and key model versus induced fit model of enzyme activity. (b) Competitive and…
A: Introduction: All the biochemical reactions are enzymes catalyzed in a living organism. Enzymes are…
Q: Determine the pKa of the amino acid using the graph graph attached:
A: Amino acids contain amino group and carboxyl group along with R side chain. The R side chain defines…
Q: What are massive, insoluble, high molecular weight compounds that have brown color? Not…
A: The brown pigment observed in different foods such as cookies, breads etc is the result of a…
Q: Draw the reactions and the interpretation on the lysine iron agar (lia) test for Proteus vulgaris
A: Proteus vulgaris is a gram negative, rod shaped facultative anaerobe in the Enterobacteriaceae…
Q: How does compromised pyruvate kinase activity lead to anemia?
A: Pyruvate kinase is a catalytic enzyme that catalyzes the final step of glycolysis, which is crucial…
Q: Why is it necessary to study the diffusion of molecules in biological systems? (а.) To understand…
A: Diffusion is the process of random motion of molecules in which there is a net flow of matter from a…
Q: Aldolase is a key enzyme in glycolysis that catalyzes the cleavage of its substrate,…
A: During glycolysis, Aldolase catalyzes the cleavage of its substrate fructose-1,6-bisphosphate into…
Q: Biochemistry: Diagram the biosynthetic pathway from precursors (like amino acids, PRPP, etc.) to…
A: There are two pathways for the biosynthesis of nucleotides: de novo and the salvage pathways. In the…
Q: Using specific examples of receptor-ligand binding, compare and contrast cell signalling by G…
A: Receptors are proteins, which bind to a specific ligand and triggers signaling pathways inside the…
Q: Basic structural component of Lipids, Protein and Enzymes?
A: A biomolecule, sometimes called a biological molecule, is any of the numerous chemicals produced by…
Q: A solution has a pH of 5.4. What is its pOH O5.4 8.6
A: The hydrogen ion concentration [H+] and hydroxide concentration [OH–] in a aqueous solution have an…
Q: sunganegy Two dialysis membranes each containing a methylene blue solution were placed in beakers of…
A: In dialysis, colloids are separated from dissolved ions or molecules of small dimensions or…
Q: 7. Which of the following is an example for a ribozyme? a. transpeptidase b. glutamyl transpeptidase…
A: Introduction: Ribozymes are ribonucleic acid enzyme that is capable of catalyzing specific…
Q: CH,O-P-o C=O 0. CH,O-P-o- CH-OH C=O Ó. HO-C-H H-C-OH H-C-OH O C-H of ČH;O-P-0- H-C-OH O CH;0-P-O 0.
A: Glycolysis is the metabolic pathway that converts glucose into pyruvic acid.
Q: Arginine is considered a basic amino acid because its side chain ________ at physiological…
A: Amino acids contain amino group and carboxyl group along with R side chain. The R side chain defines…
Q: etabolism as a determinant of bioavailability: the first-pass effect
A: Bioavailability is the rate and a particular range of the active ingredient absorption , when it…
Q: Which among the following statements is correct? Negatively-charged proteins are eluted out first…
A: Affinity chromatography is an analytical method for separating biomolecules in a mixture, based on…
Q: Using specific examples, compare and contrast G-protein coupled receptors and nuclear receptors with…
A: The binding of signaling molecules to specific receptors and production of a cellular response…
Q: What is substrate-level phosphorylation? 2. Although oxygen does not participate directly in the…
A: ATP is the energy currency of the cell and is praoduct of catabolic pathways that is used in…
Q: Which of the following is not a similarity between prokaryotic initiation and eukaryotic initiation?…
A: The initiation stage in translation starts with the binding of some initiation factors with the…
Q: Which of the following is true regarding the glycosidic bond between the pentose sugar and…
A: DNA and RNA are nucleic acids composed of nucleotide units. Nucleotides are composed of pentose…
Q: Why egg whites and milks are used as antidotes for heavy metal poisoning?
A: Heavy metal poisoning is a process in which an organism is exposed to excessive amount of heavy…
Q: In bullet form, what are the salient features and functions of steriods? Salient features of…
A: Steroids are biologically active compounds. Steroids are found in plants, animals and fungi.…
Q: Please dont copy here in Bartleby • Distinguish between a purine, pyrimidine, nucleoside,…
A: DNA and RNA are made up of long chains of nucleotides. The nucleic acid polymer has…
93
Step by step
Solved in 3 steps
- Draw a peptide for cys-asn- pro-gly (Using the same format in picture)5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above sequence? Please use the one-letter code for your answers. (You will need to consult the Table of the Genetic Code for this question) 1st letter UUU Phe UCU UCC Leu UCA UCG U UUC UUA UUG CUU C CUC CUA CUG AUU A AUC AUA AUG U GUU G GUC GUA GUG CCU Leu CCC CCA CCG ACU lle ACC ACA Met ACG GCU Val GCC GCA GCG с Second Letter Ser Pro Thr Ala UAU UAC A | AAU AAC AAA AAG GAU GAC GAA GAG Tyr CAU CAC CAA Gin CAG 1 UAA Stop UGA Stop A UAG Stop UGG Trp G His Lys UGU UGC Asp Glu G 3rd Asn AGU Ser U letter AGC AGA AGG Cys U CGU CGC Arg CGA CGG GGU GGC GGA GGG DCAG DUAG DUCAG Arg Gly UCAGDraw and label the following RNA tetranucleotide: 5’phosphoryl-A-2’O-methyl-C-U-G-3’-phosphate
- If the sequence of DNA on the template strand of a gene is AAA, the mRNA codon produced by transcription will be and will specify the amino acid A. UUU, phenylalanine B. AAA, phenylalanine C. AAA, lysine D. TTT, arginine In the given anticodon CCA - UAU - UCG, what is the resulting amino acid sequence? A. glycine-isoleucine-serine B. histidine - serine - tyrosine C. proline - tyrosine - tyrosine D. proline - isoleucine - serine Which sequence of amino acids shows the corresponding polypeptide for DNA Sequence 3' AAGGCCGCA-5'? A. phenylalanine - arginine - arginine B. phenylalanine - alanine-alanine C. lysine - alanine - alanine D. lysine -arginine - arginineThe anomer of a-D-glucopyranose is CH:OH он ÓH CH2OH он он он он CH,OH он он он он CH,OH он OH он ÓH ÇH;OH он он он онThe following amino acids that are often found inside globulin molecules are () A, Tyr B, Phe C, Asn D, Glu True of false 1. In the de novo synthesis of purine nucleotides and pyrimidine nucleotides, base rings are first synthesized and then corresponding nucleotides are formed with phosphoribose. () 2. Transcription is the process of transferring genetic information from DNA to RNA. DNA is synthesized under the catalysis of RNA polymerase, and the direction of synthesis is from the 5 'end to the 3' end. () 3. The change of protein conformation is caused by the breaking of covalent bonds within the molecule. () 4. In very high and very low pH solutions, amino acids exist mainly in non-ionic form. () 5. The active center of an enzyme usually consists of several amino acid residues adjacent to each other in the primary structure. ()
- why is CH3-CH-CH2-CH2-CH3 non imposable ? I OH5'-TAGCTGATCGAATATGCGGTCTCTATCTTCGTAGACGA-3' 3'-ATCGACTAGCTTATACGCCAGAGATAGAAGCATCTGCT -5' Determine the amino acids that will be encoded by this sequence Second letter First letter U C A G U UUU Phe UUC UUA UUG Leu CUU CUC CUA CUG Leu GUU GUC GUA GUG Val UCU UCC UCA UCGJ AUU AUC lle AUA ACA AUG Met ACG CCU CCC C CCA CCG ACU ACC GCU GCC GCA GCG Ser - Pro Thr Ala A UGU UACTyr Cys UGC. UAA Stop UGA Stop A UAG Stop UGG Trp G CAC His CAA Gin CAG GAUT GAC Asp GAA AAU Asn ACC Ser AGU AAG LYS AA Glu GAGJ Oa. N-Met-Arg - Ser-Leu-Ser - Ser-C Ob. N-Met-Pro-Arg - Asn-Asp - Ser-C d. N-Met-Lys - Val-Glu-Ala-C Oc. N-Asp-Pro-Lys - Ser - Val-Ile-C Oe. N- Met-Ala-Asp-Pro-Lys - Ser-C G CGU CGC CGA CGG AGA AGG. GGU GGC GGA GGG Arg SCAO Gly U UCAG UUA DUAG Arg G Third letter 13There is another melanocyte-stimulating hormone called β-melanotropin.Cleavage of β-melanotropin with trypsin produces the following peptidesplus free aspartic acid. WGSPPK DSGPYK MEHFRIf you assume maximum sequence similarity between α-melanotropin andβ-melanotropin, then what must the sequence of the latter be?
- With, Asp-Cys-Lys-Arg What are the pH buffering regions (pH range)? What is the charge at ph 4? Please explain how you find this out. Thanks!In pyrimidine nucleosides, the anti conformation predominates. Explain. Do the purine nucleosides have similar interactions?Draw the structure of this peptide: N-Met-His-Tyr-Leu-Asp-Ser-Arg-Leu-C