etabolism as a determinant of bioavailability: the first-pass effect
Q: When using blunt-end primers, how would you determine the correct plasmid construct from the…
A: Ligation is the joining or ligation of two nucleic acid fragments through the action of a ligase…
Q: mg/L of cell tissue and 10 mg/L of ammonia
A: TKN is refers to the term Total Kjeldahl Nitrogen which is defined as the total concentration of…
Q: On the right the Hill plot com- (b) pares the O2 binding properties of Hb Ya- kima with those of HbA…
A: The Hill plot given in the diagram shows the allosteric regulation and affinity of the different…
Q: do aklaloids minic neutrotransmitters in our bidy? amines contain: a) nitrogen atom b) an acid c)…
A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…
Q: Which statement does NOT describe a general function of the pentose phosphate pathway? Group of…
A: The pentose phosphate (hexose monophosphate shunt) process is more complicated than glycolysis.…
Q: Consider each of the following disaccharides: a) Label the acetal and hemiacetal in each…
A: Note : Hi ! Thank you for the question. We are authorized to answer three subparts at a time. Since…
Q: Which among the following correctly represents the characteristics of an anion exchanger O Anion…
A: Ion exchange chromatography a chromatographic method based on the net charge of the protein.
Q: Can you please briefly describe the reaction mechanism that permits the detection of reducing sugars…
A: Fehling's reagent is a reagent commonly employed in differentiation of water soluble carbohydrates…
Q: Draw the reactions and the interpretation on the lysine iron agar (lia) test for Proteus vulgaris
A: Proteus vulgaris is a gram negative, rod shaped facultative anaerobe in the Enterobacteriaceae…
Q: 44. Roy's doctor recommended that he watch his blood cholesterol level because his of reading of…
A: In a person, the total level of cholesterol should be always less than 200 mg/dL for a healthier…
Q: Sample Results Remarks Glycine A Methionine B Egg albumin
A: Lead sulphide test is a specific test for the detection of sulphur containing aminoacid like cystein…
Q: Which of the following products of the non-oxidative stage of PPP is an intermediate in the…
A: PPP : Pentose phosphate pathway The non-oxidative phase of PPP links the glycolysis to the pentose…
Q: COO co0 C=0 C=0 + CH2 ČH3 COO The name of enzyme that catalyzes above reaction is Select ] and the…
A: Here, a reaction is given in the question and we have to identify the enzyme which catalyzes this…
Q: please name and characterize the enzym class according to the given rraction CH CH,OH ion HO-C-H…
A: In the given reaction fructose-1,6-bisphosphate is broken into two three-carbon molecules. The…
Q: (osgnthesis
A: Retrosynthesis is a breaking down of targeting molecule by the process of ''breaking down '' a…
Q: Succinyl-CoA Synthetase mechanism Succinyl-CoA synthetase enzyme active site O Substrates bind to…
A: Succinyl-CoA-Synthetase: This is an enzyme of TCA cycle catalyze the conversion of Succinyl-CoA to…
Q: Given below is the DNA template. What are the gene products? 3’ TACCGGCCTATCTAGGGCCATGGCTTAATTCCC 5’…
A: DNA is the sequence of Nucleotides that are transcribed into mRNA during transcription. Once DNA is…
Q: 1. Stages of the insulin biosynthesis and maturation. Components: A. N-terminal amino acid. B.…
A: Introduction: Insulin is a hormone that is synthesized in the beta cells of the pancreatic islets…
Q: When phospholipids are dispersed in an aqueous solution, they will often form more ordered…
A: The phospholipids are the principle constituents of the cell membrane.
Q: In the isolation of metabolites and tests for phytochemicals, why should people dry the leaves in…
A: Phytochemicals are compounds that are produced mostly by plants and have biological activity. Plants…
Q: What are the steps in extracting DNA from a Banana using simple household materials like dishwashing…
A: DNA extraction from banana is most commonly followed as banana is triploid with three sets of…
Q: Explain the meaning of metabolic interconversion
A: Metabolism is the body's cells is used for changing the food into energy. The human bodies need this…
Q: 2. Complete and identify the enzymes involved in the following pathways OydroyacetoreP tructose…
A: The glycolytic pathway helps to metabolize glucose molecules obtained through the diet, glycogen…
Q: In size exclusion chromatography, which component will elute last in the set up? O Small proteins…
A: Size exclusion chromatography is a process of separation of molecules based on their size.…
Q: H o-H H Н-С-н `cc- .と、 H toluene phenol エ エ 工王 \\
A: Retention factor The amount which each component of a mixture travels can be easily quantified using…
Q: What happens to the functionality of a denatured enzyme? How can that resul be explained with the…
A: Enzymes are the biological catalysts that increase the rate of a biochemical reaction. They are…
Q: 7. Which of the following is an example for a ribozyme? a. transpeptidase b. glutamyl transpeptidase…
A: Introduction: Ribozymes are ribonucleic acid enzyme that is capable of catalyzing specific…
Q: Where would the catalase enzyme perform best- in the human blood stream OR in the human stomach?…
A: Catalase is common enzyme found in all aerobics and it convert reactive oxygen species H2O2…
Q: Five amino acids were subjected to normal phase chromatography, and the folkowing Rf val were…
A: Chromatography is the technique of separation of components of a mixture based on their physical…
Q: Which of the following is not a similarity between prokaryotic initiation and eukaryotic initiation?…
A: The initiation stage in translation starts with the binding of some initiation factors with the…
Q: DNA Leading strand: 5' AAA ATA | CGC TTT| TTA ATT | AAC CCC GGG 3' A I B |C| D Exons: A, C, D…
A: hnRNA is a heterogenous RNA , also called as pre mRNA formed by the enzyme called RNA pol 2 ,…
Q: A 1% by weight agarose gel is typically used in agarose gel electrophoresis. If you used a 2%…
A: During agarose gel electrophoresis, an agarose solution is prepared, it is cooled to prepare a gel,…
Q: (8) B-ketothiolase is a multifunctional enzyme in lipid catabolism. Which of the following is NOT…
A: Hi! Thanks for your question. As you have posted multiple questions and have not mentioned which one…
Q: Which reaction in glycolysis produces ATP as a product? Group of answer choices hexokinase…
A: Glycolysis : Process in which the glucose gets broken to produce pyruvate, ATP, NADH and water.
Q: Which amino acid(s) are more commonly found at the At which position(s) are amino acids limited to…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: 3. (а) 0.0050 M operate at one-quarter of its maximum rate? At what substrate concentration would an…
A: To study an enzyme kinetics, Michaelis-Menten kinetics equation is best known mathematical…
Q: 1. How is PKD inherited? What gene is responsible for the expression of PK enzyme ?
A: Pyruvate kinase deficiency is an inherited lack of the pyruvate kinase, that gets used by red blood…
Q: HN- CH H2N-CH-c-OH HaN — сн—с— он | Н-N— сн—с—он CH2 CH2 ČH2 CH2 CH2 CH2 NH2 ÓH A B D H2N-CH-C. -ОН…
A: Aminoacids are the building blocks of proteins. They have two functional groups along with side…
Q: Glucose is phosphorylated to glucose-6-phosphate by hexokinase in the first step of the glycolytic…
A: Reactions that have a positive value of Delta G are not favorable in nature. Hence in order to…
Q: Starting with a 4-carbon growing fatty acid attached to the ketoacyl synthase (KSase) site, and a…
A: Fatty acid metabolism includes Fatty acid biosynthesis (an anabolic process) and β-…
Q: What is the purpose of acrylamide and bis-acrylamide? in SDS-Page Gel
A: Sodium dodecyl sulphate-Polyacrylamide gel electrophoresis (SDS-PAGE) is a common analytical…
Q: 8. Which of the following is commonly known as the Complex II of the electron transport system of…
A: Electron transport chain is a series of protein and organic molecules located in the inner membrane…
Q: Reactions and Thermodynamics of Glycolysis
A: Third step of glycolysis, fructose-6-phosphate is converted to fructose- 1,6-bisphosphate by…
Q: HbA1c is used to monitor blood glucose levels because hemoglobin is the only protein in blood that…
A: “Since you have asked multiple question, we will solve the first question for you. If youwant any…
Q: rue or False? a. Ribose and deoxyribose are formed from glucose.
A: Ribose is a pentose sugar with molecular formula C₅H₁₀O₅, it is the prime component of…
Q: Visceral fat loss is often associated with increased insulin sensitivity. Assuming that with the…
A: D. -10.6
Q: True or False? a. An excess of amino acids can result to the destruction of proteins.
A: The destruction of proteins in cells can occur when due to misfolding and aggregation of proteins…
Q: Draw the dipeptide that results when a peptide bond is formed between the two glycine molecules…
A: Introduction: Amino acid is a compound that contains an amino and a carboxyl group and a side-chain…
Q: considering mating a black hearing male Labrador dog (homozygous in both alleles) with black deaf…
A: According to the given question, the male is black hearing Labrador dog and is a type of a…
Q: What are other staining methods that can be used for PAGE?
A: Introduction: PAGE electrophoresis is a subtype of gel electrophoresis whereby normal gel is…
Can you please elaborate about the
Step by step
Solved in 2 steps
- Name: Hendric Nduwuba DNP and Cellular Respiration Summary https://www.youtube.com/watch?v=eLtRan2qFx0 Your assignment today is to summarize in two paragraphs (8 sentences total) the effects of dinitrophenol (DNP) on the human body. Make sure you explain what DNP is, the stages of cellular respiration, and how DNP alters the metabolism of the person using it (side effects). The following vocabulary terms need to be used: cellular respiration, adenosine triphosphate, and dinitrophenol (DNP). Your objective is to describe the role of ATP in cellular respiration in order to explain how DNP affects the rate of metabolism. The first paragraph is an introduction to the summary and the second paragraph is an explanation of the main idea. You will be graded on this criteria: main idea, explanation of cellular respiration, explanation of DNP, and paragraph structure.This is a Biochemistry Question! Please select all of the following processes that would INCREASE during untreated or badly managed diabetic ketoacidosis: (More than 1 answer) 1) there is fluid and electrolyte loss in urine 2) plasma pH 3) Glucose uptake & skeletal muscle using as primary fuel 4) Bicarbonate reabsorption & renal Hydrogen excretion 5) Relying on fatty acids & proteins as primary fuels throughout the body 6) Gluconeogenesis, Fatty acid oxidation, & ketogenesis (all within the liver) 7) Lipolysis & fatty acid release from adiposeThank you so much. I had already calculated this exercise, but I thought that I did it wrong, however I get same result as you. Reason for thinking I had done it wrong is that, my teacher have answered this exercise before and the second part is different than mine and yours. I dont understand how she get the value for second part? It's so confusing
- Please kindly mention the vitamins and discuss their role in metabolism pathways?Hello there! Please help me with these problems. I would appreciate it if you write me a short explanation of why you chose one of the answers. Not necessarily though, just if it makes sense to write me a little explanation.A. Which of the following is not true for the nutrition label? the serving size reflects the amount that people typically eat or drink all the nutrient amounts are shown on the label, including the number of calories, refer to the size of the serving the serving size is a recommendation of how much you should eat or drink all of the above 5. none of the above B. Which of the following is true for all nutrition food labels? they have colored sections to help you focus on the different sections of information on the labels the calories posted on a label provide a measure of how much energy you get from a serving of this food they are required to have colored sections to help you focus on the different sections of information on the labels A & C none of the…Please help me with these two questions. Thank you in advance.
- Discuss the biochemical processes that contribute to maintaining caloric homeostasis..Let me Give a schematic diagram of how we can nonpharmacologically manage Lactose Intolerance ? Please answer at your own words?Hello good day, I am having a problem answering this question and I need your help on this. Hoping for a response and thank you In each chosen disease, pls. supply the information below: So I've chosen "Biotinidase Deficiency", so I need a short description, its pathophysiology, laboratory diagnosis, and Treatment and Prevention of my chosen disease. Thank you. a. Short Description b. Pathophysiology c. Laboratory Diagnosis d. Treatment and Prevention