Detail how the factors that affect reaction time and decision-making help cheerleaders hit their stunts perfectly?

Q: What are some of the functional and evolutionary advantages of gnathostomes?

A: Gnathostomes are vertebrates that have jaws. Having jaws has an evolutionary advantage for this…

Q: Hereditary hemochromatosis is an autosomal recessive genetic disorder that causes the body to absorb…

A: Mutations are alterations in the DNA sequence of an organism. Small changes, such as adding or…

Q: Which of the following options best explains natural selection? Mark only one oval. An organism with…

A: In evolution the term natural selection coined by Charles Darwin. He gives the idea about the…

Q: Skeletal muscles account for approximately 43% of the typical body mass. At rest, they use about 18%…

A: Skeletal muscles account for approximately 43% of the typical body mass. At rest, they use about 18%…

Q: The answer did not address why most cancer mutations occur upstream of MAPK (ie. RAS (10-20% NRAS…

A: RAS protein is monomeric G protein , it will belongs in the GTPase super family of intracellular…

Q: 1. Cite examples of plants that you can identify as monocot or dicot based on the appearance of its…

A: Monocots and Dicots are the two types of vascular plants. The quantity of cotyledons is the most…

Q: Give a part of the body that uses the 2nd class lever system

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: In humans, blood pH is maintained fairly precisely around 7.4, and this is largely accomplished with…

A: The pH of blood is maintained mainly by organs like lungs, kidneys and by the internal buffer action…

Q: What would happen if a mutation changed a codon for an amino acid to a stop codon? How about if the…

A: Mutations are changes in DNA sequences. Mutations can occur due to changes in the sequence of bases…

Q: 14. Female gonads that produce eggs and the female sex hormones. About 3 cm by 1cm in size 15.…

A: 14) Ovary : these are female primary sex organs and here oogenesis or process of formation of female…

Q: What are the six functions of the plasma membrane?

A: A biological membranes which serves as a barrier between a cell's outside and inner surfaces is the…

Q: sperm cells are formed when the generative cell divides by _________

A: The flowering plants in the plant kingdom are the Angiosperms. They produce fruits and flowers and…

Q: evaluate how suited it is for raptors birds to survive on both the west island and the east islands…

A: Bird: Birds are warm-blooded animals of the Aves class. Birds' body is covered in feathers,…

Q: Consider the following image that shows the membrane potential in a neuron when it is transmitting…

A: In a resting nerve fibre that is not conducting any impulse, the axoplasm is contains high as conc.…

Q: Why are there so many serotypes of the same bacterial parent strain? O Mutability O Genetics All…

A: Serotype  A group of same species having distinct surface antigen receptors.

Q: What is the most likely mode of inheritance for this trait? I 1 2 1 2 3 4 6 7 OLO 2 3 4 5 6 7 8 9 10…

A: In the given pedigree, the trait do not skip generations. This implies that the mode of inheritance…

Q: Cross #1: P: F1 Fs Homozygous scarlet-eyed males Homozygous brown-eyed females X 1072 Wild-type…

A: 1. F2 generation phenotypic ratio is the chance of getting scarlet eyes, and  brown eyes is Half…

Q: A perfect flower is one in which both ________     and ______________      are present.

A: Flower The flower is defined as the reproductive part of the plant which contains male and female…

Q: A researcher was trying to determine whether two molecules (A and B) were corepressors or inducers…

A: Gene expression is predominantly regulated at the transcriptional level, owing to protein binding to…

Q: In the following pedigree of an autosomal recessive trait, which individuals in generation III…

A: Autosomal recessive traits:  The traits present on chromosomes other than sex chromosomes, the…

Q: Experiment on The Predator-prey Interactions Between Zebrafish and Daphnia 1. Six 1-L beakers were…

A: A small planktonic crustacean is the Daphnia, these are the prey for the predators-zebrafish.

Q: Natural Selection causes: * Mark only one oval. Changes in the environment All plants and animals to…

A: Introduction Natural selection:- It is a phenomenon in which organisms possessing favorable traits…

Q: Scientists were able to develop transgenic bacteria that can be used for mercury remediation.  This…

A: 1. The answer is C. DNA polymerase Plasmid- circular DNA in bacteria. The genes to be introduced are…

Q: Describe how the nervous system and the endocrine system work together in the fight-flight response.…

A: Our body is well equipped to make us ready for an event of stress and immediately turning all the…

Q: A. You have 3% (w/v) concentrated saline in 20 mL ampoules. What volume and how many ampoules do you…

A: Please note, as per the site guidelines and in order to provide accurate and good quality answers,…

Q: make a summary of the importance of atleast ten different cell parts or organelles in the normal…

A: Introduction Cells comparison with the family and organelles to its family members is typical to…

Q: Globular cells are said to be spherical. When slightly flattened, they are disc-shaped. Squamous…

A: Ques : What is the shape of the  cartilage cell(1), bone cell(2), and  cardiac muscle(3) specimens?…

Q: 1 Annotate Figure 16.5, which is a schematic of the replication fork. a. In each box, write the name…

A: DNA replication  The process by which DNA duplicate itself.

Q: PART B Re-watch the video and explain why the following steps are necessary: Why use tweezers to put…

A: Please note as per the site regulations, external links are not watched. Hence, part A cannot be…

Q: Using the Punnett's Squares below, name the offspring of all possible parent combinations. T T T t T…

A: TT TT TT TT So here all offsprings will be tall (homogeneous dominant).

Q: Many dairy operations keep cow’s milk for sale and use formula to raise any calves. The farmer…

A: Calf Diarrhoea is also known as scours, is a conditions that can be caused by many different factors…

Q: Imagine mermaids are real. What are the advantages and disadvantages of mermaids whether on land or…

A: Anatomy, which reveals that evolutionary ties may be proven through homologous structures, and…

Q: In the following pedigree of an X-linked recessive trait, which of the numbered individuals MUST be…

A: X linked trait are the disease related to the sex chromosomes or can be called the X chromosome .And…

Q: What are the frequencies of alleles A and a in the founder generation? b. Is the founder generation…

A: NOTE:- Thanks for mentioning, but all must be answered to understand completely as the answer lies…

Q: Food Web Construction Directions: Construct a food web using the following organisms…

A:

Q: Label the leaf diagram: air space, cuticle, epidermis, guard cells, palisade parenchyma, spongy…

A: Leaf The leaf is the green outgrowth from the stem of the plant. It is the primary site for the…

Q: Given this DNA strand: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ Identify the following: mRNA:…

A: The process by which DNA is copied to RNA is called transcription, and that by which RNA is used to…

Q: Suppose a genome-wide association study (GWAS) investigation found a particular single nucleotide…

A: A sort of genetic difference within humans can be called single nucleotide polymorphisms or SNPs.…

Q: What do you think is/are the characteristic of sulfamethoxazole (antibiotic) that allows it to…

A: This is the structure of Sulfamethoxazole.

Q: "Which of the following cell processes depend on the movement of membrane components and would not…

A: Introduction The cell membrane or plasma membrane is present in all cells and helps to separate the…

Q: The urinalysis came back for your patient, it was amber, non-cloudy, no WBC, no RBC, there was…

A: When the kidneys stop functioning properly, it's known as acute kidney injury (AKI).

Q: How many binding sites are uncovered for each molecule of troponin that binds to calcium

A: Introduction:- In muscular contraction, calcium plays a vital regulatory role. Its presence in a…

Q: Name: 1. The Excretory system converts dangerous nitrogen-based waste into a. Carbon dioxide b.…

A: 1. The Excretory system converts dangerous nitrogen-based waste into a. Carbon dioxide b. Sweat C.…

Q: In the following pedigree of an autosomal recessive trait, which individuals in generation III…

A: Pedigree is a family chart showing the inheritance of a particular trait through several generations…

Q: 2. Why was sterile water used? 3. Why shaking the tube is important before diluting?

A: Microbiologists do successive dilutions to generate lowering concentrations of the original sample,…

Q: How is the topic about climate change, the effects of human activities and the species verge of…

A: Humans and wild animals face new challenges for survival because of climate change. More frequent…

Q: Imagine if mermaids are real. What are their biological and Physical demands (CORRECT SHAPE AND…

A: The aquatic ecosystem is a critical component of the Earth's thriving process and is required for a…

Q: 8) Define the following terms: a. Hydrophobic b. Hydrophillic

A: Introduction The cell membrane is a thin semi-permeable membrane that surrounds the cytoplasm of a…

Q: Identify the 4 components needed to start a PCR reaction (equipment not included)

A: A basic PCR set up requires the following essential components and reagents- 1. Template DNA…

Q: Which of the following conditions will result to deactivation of a gene? a. histone methylation b.…

A: In this question we have to describe about regulation of genes . See full answer in step 2.

Learning and memory

Learning is defined as a relatively permanent and irreversible adaptive change in behavior. It always results from experience. The ability of an organism to store and recall the effects, sensations, and knowledge gained through learning and experience is called memory.