Q: In cattle, the gene for hornless (H0 is dominant to the gene for homed h), the gene for black (8) is…
A: Given: In cattle, Gene for hornless (H) is dominant to the gene for horned (h). The gene for black…
Q: 1. A package of nuts contains 3 servings, and each serving contains 150 calories. If you eat the…
A: A calorie is a unit of energy. It refers to the energy people get from food and drink they consume.
Q: In a eukaryotic cell, the majority of the organelles are located in the: cell wall O coelom…
A: Eukaryotes are cells that are complex in structure and function As they have the membrane bound…
Q: How are antibodies to Salmonella H antigen produced? A) antibodies to H antigen are isolated from…
A: Salmonella is a bacteria. It has H antigen on the flagella. It is a slender thread like portion on…
Q: What are the functions of ovaries in a flowering plant?? A. TO PRODUCE FEMALE GAMETES B. TO PRODUCE…
A: ovary, in flowering plants is enlarged basal portion of the pistil, the female organ of a flower.
Q: Why is bush encroachment a common characteristic between Sweet and the Sour veld, veld types whereas…
A: A veld which is also commonly known as veldt is large landscape that is open and flat. Perennial…
Q: How could you prove that the Tn5 insertion was in the lac operon?
A: Genetic engineering (GE) is the intentional change of an organism's genetic structure, which…
Q: Explain how human hunting has affected the traits of the African elephants. Explain why being a…
A: Elephants are the largest land mammals on earth and have distinctly massive bodies, large ears, and…
Q: nscript: 3' TACAGTTAAGGCTCCACTGTTA 5' 5' 3' ino Acid Sequence (ex. Met-Trp- and so on) Second letter…
A: The genetic code is the relationship between the sequence of bases in DNA and the sequence of amino…
Q: 4. WATER HAS THE PROPERTY OF ADHESION, WHICH ALLOWS IT TO USE WHICH PROCESS IN PLANT ROOTS? A:…
A: Ans is.. capillary action
Q: song an When researchers gave pair-bondec amine in their drinking water, the u oxytocin. What effect…
A: The prairie vole animals have been studied for doing research in oxytocin animals .this is because…
Q: If a phage is undergoing lytic growth, which protein is bound to the operator region? O Both Lambda…
A: In this Particular question we have to describe about regulation of lytic cycle.
Q: Pyruvate from glycolysis is oxidized by ATP. in the mitochondrial matrix. a. b. to release water. C.…
A: Aerobic respiration :- it is the process of cellular respiration that takes place in presence of…
Q: Give the common characteristics of animals that falls under the category of Family: Felidae in…
A: INTRODUCTION Felidae is a clade of mammals belonging to the order Carnivora and is commonly referred…
Q: - Coronary arteries route oxygen rich blood into the tissues of the heart. of the: d. descending…
A: Two major coronary arteries branch off from the aorta. They branch off from a point where aorta…
Q: 3. In excitable cells, depolarization is most closely associated with which of the following events?…
A: INTRODUCTION A neuron is the basic functional structure of the central nervous system. Neurons are…
Q: what are 4 antagonistic interaction between two or more species that are exploited to improve…
A: Antagonist interaction between two species is the negative interaction where one species is…
Q: A population has 700 individuals, 85 of genotype AA, 320 of genotype Aa and 295 of genotype aa. What…
A: The Hardy-Weinberg equation is expressed as: p2 + 2pq + q2 = 1 p is the frequency of the "A" allele…
Q: 1. Summarize the blood level data with a frequency distribution. 2. Calculate the arithmetic mean.…
A: There are few important points to remember : Mean : It is defined as sum by number of its value .…
Q: 1 2 10 3 11 12 13 5 14 15 6 8 16 Figure 8.1 Muscles in the dorsal side of the frog
A: Soft tissues include muscles. Your muscles are made up of many flexible fibres.
Q: What are 4 mutualistic and 4 antagonistic interaction between two or more species that are exploited…
A: Four mutualistic interactions- 1. Aphids and ants- Aphids are sap-sucking insects that exude…
Q: Dropping Mercury Electrode
A:
Q: differences between three domain and five kingdom schemes of biological classification.
A: Introduction Taxonomy is the science of identifying, categorizing, and describing groupings of…
Q: A series of two-point crosses were carried out among five loci (E, F, G, H, and I), producing the…
A: When two genes are near enough on the same chromosome, they are considered to be connected because…
Q: How large (as a proportion of body size) should the testes of chimpanzee males be relative to…
A: The testicles are responsible for making testosterone, the essential male sex hormone, and for sperm…
Q: QUESTION 9 For the mating below, indicate whether nondisjunction occurred in the mother, father,…
A: Introduction Genetic analysis refers to the general process of studying and investigating genetics…
Q: Animal Diversity Second mouth Symmetrical animals Asymmetrical animals Spiny skin Radial symmetry…
A: These are term related to animal diversity.
Q: Describe how ecology affects evolution. Provide an example in which the ecological interaction…
A: Ecology is the inter relationship between the biotic community and abiotic environment. Because it…
Q: How does natural increase, natural decrease, equilibrium affects or influence the population and…
A: Typically, population refers to the number of people in a certain place, such as a city or town,…
Q: in certain fish the mating of black-scaled (B) with white a white-scaled (W) will create offspring…
A: Introduction :- Fish are aquatic vertebrate animals having gills but no digits on their limbs, such…
Q: If your 16x concentrated stock solution contains 20g of Nacl per liter, how much NaCI would one…
A:
Q: 6. Describe one major event in Earth’s natural history. The event can be an evolutionary innovation…
A:
Q: A condition wherein the presence of a certain allele causes death of the organism. O lethal genes O…
A: a condition wherein the presence of a certain allele causes death of the organism is called lethal…
Q: AC CAG CCC AAG ATT ____________ Transcription: Translation:
A: The flow of genetic information in a biological system is explained by central dogma and it involves…
Q: Albinism is a rare genetically inherited trait that is only expressed in the phenotype of homozygous…
A: The homozygous recessive genotype (aa) caused albinism in the population. AA and Aa genotypes encode…
Q: A pregnant woman is carrying a triplet inside her womb. They want to determine the number of boys or…
A: Probability of having a boy or a girl is always 1/2.
Q: 25. Modern agroecosystems differ from natural ecosystems in all of the following ways except: A.…
A: Answer
Q: Metalloprotein linkages are most likely to be formed between: a.Two cysteines b.An arginine and a…
A: Metalloprotein linkages are most likely to be formed between?
Q: 1. ____ are phospholipid with serine at coe that forms rafts that float about within the membrane.…
A: A phospholipid is a lipid with a phosphate group that is found in large amounts in cell membranes.…
Q: What are the best adaptations and modifications of protozoans? Cite specific examples per group. 2.…
A: Protozoa are minute, mostly microscopic animals. Most protozoans are free living in water and some…
Q: Based on the milkfish dissection, describe the structure of skull and vertebral column design. How…
A: Answer :: Milkfish (Chanos chanos) is the only fish species that belongs to Family Chanidae which is…
Q: Heat-sensitive film, which captures the body temperature of organisms on film, is used to photograph…
A: Homeostasis refers to the process of maintaining internal physiological parameters in a changing…
Q: DNA Sequence Enter DNA sequence below Original sequence ATGCCAGGCGGCGAGAGCTTGCTAATTGGCTTATAG…
A:
Q: 43) Topic of Lipids A second big category of lipids are isoprenoids. What are three precursors to…
A: Isoprenoids are a broad class of natural products commonly found in plants and other living beings.…
Q: Jay has been suffering from diarrhea for the last 3 days what do you think has happened to his…
A: Homeostasis refers to the process of maintaining internal physiological parameters in a changing…
Q: If an embryo splits at the two-cell stage, each of the resulting identical twins will have its own…
A: Identical twins: The splitting up of the embryos into two at the two-cell stage leads to the…
Q: List all the etiologic agents of superficial and cutaneous mycoses
A: Fungal infections, also known as mycoses, are responsible for a wide range of diseases in humans.…
Q: The hydrolysis of ATP requires a. energy. b. water. C. a high temperature. d. energy and water. e.…
A: Answer is.. Water (b)
Q: If the molecular weight of E.coli DNA is taken as 2.7x10 and the average molecular weight of any…
A: Note: The Values given in the question may be different as in original question, but concept is…
Q: Which of the following does NOT play a role in DNA replication? O helicase promoter O ligase…
A: ANSWER;- None of the above Explain;- Does not play a role in DNA replication is a stop codon. -Stop…
- Describe the probable root system of a crop that has been applied with frequent, light, and widely spaced heavy irrigation.
Step by step
Solved in 2 steps
- Describe the probable root system of a crop that has been applied with frequent and lightdescribe the various stages that are involved in plant regenerative techniques associated with the production of 'clean' planting materials for farmers' use.Discuss the relationship between soil resilience and factors of soil formation.
- List two advantages of using sprinkle irrigation for grasses rather than using drip irrigation.Briefly describe the good harvesting practices to optimize the post-harvest quality of fresh fruits and vegetables.Enlist the principles of crop production, discuss the importance of timely and accurate provision of plant protection measures in detail.
- How can tissue culture techniques be used to study the effects of environmental factors, such as temperature, humidity, and light intensity, on the growth and development of plant cells and tissues, and how can this knowledge be applied to improve crop yields and plant resistance to abiotic stress?Explain the relationship between soil particle size and the field capacity of soil.This is about Land Preparation and Field Practices for Lowland and Upland Crops. Kindly answer and explain.
- Compare and contrast between lowland (rice) and upland crops (choose one among coconut, mango, banana, corn, soybean, or sweet potato) in terms of (1)land preparation (2) procedure, and (3) objectives.indebt Land Preparation/ Planting Management Practices that are involved in the commercial cultivation of cabbage.shed light on ideal soil type and root depthWhy do pasture grasses continue growing despite being grazed upon by animals and why do lawn grasses continue growing despite being trimmed regularly? *