Q: Why is bush encroachment a common characteristic between Sweet and the Sour veld, veld types whereas…
A: A veld which is also commonly known as veldt is large landscape that is open and flat. Perennial…
Q: 24. The most destructive practice of harvesting wood products, which cuts down all of the trees in a…
A: Clear-cutting is a silvicultural system that removes an entire stand of trees from an area of 1 ha…
Q: Which of the following would NOT leac protein denaturation? A. A pH change B. A covalent compound C.…
A: In biology, denaturation is the modification of a protein's molecular structure. Many of the weak…
Q: 1. Explain the role of Statistics in biological science.
A: Statistics is the discipline that concerns the collection, organization, analysis, interpretation,…
Q: Explain in 2 or 3 paragraphs- Phenetics vs Cladistics
A: There are few important points that should kept in mind : As we know that classification is the…
Q: This question follows from the last question The D value for a resistant strain of bacterial spores…
A: Time required to ensure a SAL of 10^6.
Q: 3. The data in Table 3.1 are from an investigation of an outbreak of severe abdominal pain,…
A: A frequency distribution is a list, table, or graph in statistics that shows the frequency of…
Q: Ray-finned fish Rodents & rabbits Crocodiles Birds Sharks Amphibians Primates Hair Eggs with shelle…
A: The phylogeny tree is given in the image. It depicts the relationship between the taxons present in…
Q: discoideum) occasionally aggregate into a colony. About 20 percent of the amoebae in the colony make…
A: Kin selection favors the reproductive success of the other relatives even at a cost to the…
Q: To explain: The way in which the plants with nodules for nitrogen-fixing bacteria might…
A: Nitrogen fixation is the process through which atmospheric nitrogen is converted to ammonia through…
Q: ONE OF THE ANSWER IS WRONG PLEASE HELP ME FIND THE RIGHT ANSWER Duplication of genes is an…
A: Dominant alleles are always expressed whether present in homozygous or heterozygous forms. Where as…
Q: The erythrocyte sedimentation rate (heaviness) testis oftenusedfor a blood sample as a diagnosis of…
A: Erythrocyte sedimentation rate: The erythrocyte sedimentation rate (ESR or sed rate) is the rate at…
Q: QUESTION 1 Loci Recombination Frequency (%) L and M 50 L and N 19 L and O L and P 50 50 M and N 50 M…
A: The test cross is done to find the genetic map. The crossing of unknown parent is done wit…
Q: How are antibodies to Salmonella H antigen produced? A) antibodies to H antigen are isolated from…
A: Antibodies are the proteinaceous substances which are produced by the B cells of the immune system.
Q: Calcitonin is enzyme that functions to reduce blood calcium levels True O False CK may be derived…
A: Storage lipids, also known as triacylglycerols, membrane lipids, which include glycerophospholipids…
Q: The probability of having an individual with a least a heterozygous gene pair on its genotype from…
A: The two genes are involved in this case. That's why it is a case of dihybrid cross.
Q: 1. The rubella virus causes German measles. If a pregnant woman is is infected by the rubella virus…
A: Introduction Rubella, often known as German measles or three-day measles, is an infectious disease…
Q: 2. Next, use the Hardy-Weinberg equation (p + 2pq + q = 1) to calculate the expected frequencies of…
A: Answer given below. If you like the answer please rate. thank you.
Q: 25. Modern agroecosystems differ from natural ecosystems in all of the following ways except: A.…
A: Answer
Q: DNA Sequence Enter DNA sequence below Original sequence ATGCCAGGCGGCGAGAGCTTGCTAATTGGCTTATAG…
A: DNA contains the genetic information about the characteristics features of te organism present in…
Q: Can gelatin hydrolysis be correlated with the pathogenicity of a bacterium? Explain your answer
A: Disclaimer: “Since you have asked multiple questions, we will solve the first question for you. If…
Q: What is the principle behind a UV-Vis spectrophotometer, and what are its key components, and how…
A: UV-vis spectrophotometry or UV spectroscopy types of absorption spectroscopy or reflectance…
Q: How many amino acids would there be in the protein produced from the following mRNA molecule ?…
A: 1. Stop codons- UAA, UAG and UGA. Codon consists of 3 nucleotides. There are 11 codons, but 10…
Q: 1) A molecular biologist creates a form of RNA polymerase that has the same proofreading ability as…
A: Advantage Proof reading ability of DNA polymerase reads the error added codes in DNA and correct…
Q: GENERAL BIOLOGY 2 Q1 : How can plants reproduce naturally?? A. Using anthers B. Using cuttings C.…
A: plants reproduce naturally by Using runners.…
Q: 2. Choose the appropriate boxes describing what happens to the pH and separately the Alkalinity of a…
A: Seawater is under constant threat of acidification which might harm the growth and survival of…
Q: Calculating the probability of two parents - each coming from a large family with a history of a…
A: Mendel uncovered the fundamental laws of heredity. His experiments demonstrated that the inheritance…
Q: In owl, barring (B) is sex linked and dominant recessive allele (b) producing solid black color when…
A: As per the guidelines, we are supposed to answer only three sub-parts. Kindly repost the question…
Q: In a canine expt, a dog’s filtered load of sodium (Na+) in an isolated pump-perfused kidney is found…
A: Given: Filtered sodium Na+=15 mmol/min To find: To find the volume of Na+ that remains in the tubule…
Q: Which of the following would apply to desmosomes that are found in cells as they migrate from the…
A: The stratum corneum is the outermost layer of the epidermis and it marks the final stage of the…
Q: If a phage is undergoing lytic growth, which protein is bound to the operator region? O Both Lambda…
A: INTRODUCTION Lytic stage of phage This is the reproductive stage of bacteriophage it include 6…
Q: Explain in 3 paragraphs what is coevolution and its types (pairwise, diffuse, and genefor gene…
A: Coevolution It is defined as the process of evolution of two species in a mutually dependent…
Q: The sodium pump is an example of a catabolic process. an anabolic process. stored energy. a. b. C.…
A: The sodium-potassium pump is an example of an active transport membrane protein/transmembrane…
Q: Describe one function, brought about by the process of meisos, that spermatogenisis and oogenisis…
A: Common function between spermatogenesis, oogenesis and meiosis :-
Q: Question 4 (1 point) Metabolism refers to burning food during physical activity like running.…
A: The true answer is... All of these (e)
Q: Give an example of a physiological adaptation using organs and/or tissues of an organism of your…
A: A metabolic or physiologic adjustment within an organism's cell or tissues in response to an…
Q: The job of a ribosome is to: make an mRNA transcript of DNA synthesize a new strand of DNA using the…
A: INTRODUCTION Protein synthesis is the process in which the formation of new proteins takes place. In…
Q: 4. Give at least 2 major contributions of Cambrian explosion to evolution
A: 4. The Cambrian Period is significant in the evolution of life on Earth since it is when most of the…
Q: To explain: Whether humans are dominant species or key ştone species.
A: A species is a group of organisms with genetic similarities, the ability to interbreed, and thus the…
Q: The O-antigen is part of the bacterium's which is found in the outer membrane of some bacterial cell…
A: O-antigen plays a very important role in microbes and host interaction. It is generally present in…
Q: Indirect bilirubin water insoluble * True O False The ALP are a group of enzymes that hydrolyse in…
A: Bilirubin is found in 2 states ; Direct and Indirect bilirubin. Indirect bilirubin is not conjugated…
Q: I. CASE ANALYSIS. Read carefully the scenario below and answer the questions that follow. AAG Lys A…
A: Forensic analysis using DNA samples The DNA sequences can be a helpful tool to determine the…
Q: 4. Describe the process of alternation of generations using any plant phylum as an example. In your…
A: Introduction :- In plants and algae, the most common type of life cycle is generational alternation.…
Q: Give at least 5 observations from the structures based on fish dissection?
A: Given: For the fish dissection procedure one would require, Medium sized - fish to visualize all the…
Q: SEQUENCING: Arrange thes systems of animals. Assign nur your notebook. 10. receptor potentia 11.…
A: Reflex arc Pathway along which nerve impulses travels during the reflex action.
Q: The following graph depicts the relationship between the mean flower depth of Zaluzianskya…
A: Introduction Evolution is the process of a species' features changing over numerous generations…
Q: To describe: The ecological niche of humans.
A: The intended function that an organism performs within an environment is its niche. The biotic…
Q: If a plant’s stomata are made to stay open at all times, orclosed at all times, it will die. Why?
A: Stomata are the tiny holes which are present on the surface of the leaves. The function of the…
Q: Question 5 Describe briefly the TWO distinct roles of the v-SNARE and t-SNARE proteins in vesicle…
A: Role of SNARE proteins in vesicle transport :-
Q: 4. Mr. Salazar has Type A blood while Mrs. Salazar has Type B. They have four children. Bobbie has…
A: Given - Blood type of Mr Salazar - A Blood type of Mrs Salazar - B Therefore, Possible genotypes of…
Describe the probable root system of a crop that has been applied with frequent and light
Step by step
Solved in 2 steps
- Describe the probable root system of a crop which has been applied with frequent, light and widely spaced heavy irrigation.describe the various stages that are involved in plant regenerative techniques associated with the production of 'clean' planting materials for farmers' use.indebt Land Preparation/ Planting Management Practices that are involved in the commercial cultivation of cabbage.shed light on ideal soil type and root depth
- Enlist the principles of crop production, discuss the importance of timely and accurate provision of plant protection measures in detail.This is about Land Preparation and Field Practices for Lowland and Upland Crops. Kindly answer and explain.Discuss the relationship between soil resilience and factors of soil formation.
- Classification of the different morphological characteristics according to crop productivity, adaptability and marketability of certain crops. Morphological Characteristics Plant Example Productivity Adaptability Marketability 1. large root 2. leaf/stem with trichomes 3. numerous petals 4. enlarged stem 5. numerous tillers 6. large/numerous pods 7. large leaf 8. overlapping petals/sepals 9. stem/root nodules 10. separate male/ female flowers 11. fibrous/extensive root system 12. brace roots 13. short internodes 14. waxy thick leaves 15. large flowers 16. long stalkHow can tissue culture techniques be used to study the effects of environmental factors, such as temperature, humidity, and light intensity, on the growth and development of plant cells and tissues, and how can this knowledge be applied to improve crop yields and plant resistance to abiotic stress?Describe the method of preparation of planting material for Ginger and describe how it can be propagated