Describe the body’s natural defenses in each of the body systems. Identify the role played by the normal biota in defense of each of the body systems.

Q: In this activity, you will: 1. Observe life forms other than those you studied from Grades 3 through…

A: This activity is about different types of living beings. Living beings carry out various life…

Q: Explain why infections caused by fungi, protozoans, and helminths are more difficult to treat than…

A: Introduction :  An infectious disease is a condition that develops as a result of a pathogenic…

Q: There are several factors that contribute to high fidelity of DNA replication. Which of the…

A: To preserve genetic integrity and to ensure genetic continuity, DNA that is transferred to daughter…

Q: Explain how ALS leads to physiological symptoms

A:

Q: Glycolysis occurs in what part of the cell? O eukaryotes: inner membrane of mitochondria;…

A: Question : Glycolysis occurs in what part of the cell ?   Answer : Eukaryotes : cytosol ;…

Q: Which of the following statements concerning p53 is NOT correct? O a. O b. O C. p53-dependent…

A: p53 is a gene that helps to control the cell cycle and prevent cells from becoming cancerous. It…

Q: if you were to measure the PH of chyme in the duodenum and found it to be between 7 and 8, would…

A: When the food that has been consumed reaches the stomach it undergoes digestion by muscular…

Q: Protein structure is central to our understanding biological systems. The tubular proteins that make…

A: Primary, secondary, tertiary, and quaternary structures are the four levels of complexity that can…

Q: Imagine you are planning to visit a family member who is a nursing home resident. The nursing home…

A: In that case we have to test RT-PCR test

Q: Outline the general process of transcription (dna->rna) include a diagram a) include the basic…

A: Transcription is the process of synthesis of RNA from DNA. It involves three steps, initiation,…

Q: List some genera of free-living and symbiotic nitrogen-fixing bacteria.

A: Nitrogen-fixing bacteria are microorganisms that convert nitrogen gas from the atmosphere into a…

Q: In a homeostatically regulated system, diagram or identify the regulated homeostatic variable,…

A: External substances that disrupt the generation, secretion, distribution, metabolic activity,…

Q: 2.- Draw a step by step diagram of the translation process then explain what is happening in each…

A:

Q: 4. Describe what happens when a nonsense mutation is introduced into the gene encoding transposase…

A: Mutations are sudden changes to the DNA sequence of an organism that is the result of errors during…

Q: The next several questions refer to the data given in this problem. You sample a population of…

A: The factors that induce changes in allele frequencies over time are natural selection, genetic…

Q: Movement is a type of response to stimuli. Many unicellular organisms can move in response to…

A: Stimuli is an external input to a living organism, such as a sight, sound, smell, or touch, which…

Q: Hơ many mismatches would you expect to find between this sequence and the reference sequence? I…

A: Mutation is any alteration or modification or change in the nucleotide sequence, resulting in a…

Q: what is the frequency of the rarest variant you can detect during deep sequencing of a tumor cell if…

A: A tumour cell is a type of abnormal cell that is produced and reproduces at an abnormally rapid…

Q: 4.08 H H ↓ 1.02 ↓ | 2.54 11.02↑ E E Note: 1.67 = EXON = INTRON E 10.8 kbp 3.94 3.66 E = EcoRI site H…

A: Endonuclease HindIII is a type II restriction enzyme that recognizes and cleaves the palindromic…

Q: Bacterial DNA Process 1 Process 2 C. Human DNA a. Process 1: Restriction enzyme Process 2: Ligase…

A: Recombinant DNA technology is a method by which jeans are combined from two different sources in…

Q: 5. › Polyphenoloxidase is involved in the darkening of wheat products due to its oxidative effect on…

A: Enzymes are biocatalysts which increase the rate of chemical reaction by decreasing the activation…

Q: Central African chimpanzees (Pan troglodytes troglodytes) and bonobos (Pan paniscus) are two…

A: The events that are responsible for the evolution of species from the ancestral population is called…

Q: State and recognize the three basic nutritional needs an organism’s diet must satisfy. List the…

A: Food consists of nutrients. Nutrients is categorised into seven major groups carbohydrates,…

Q: Structural differences between a B cell and a plasma cell in relation to their function?

A: Immune cells are an important part of our body that helps to protect us by developing immunity. B…

Q: In eukaryotes, fatty acids are stored as triglycerides in cells that have A) Golgi that store fatty…

A: In eukaryote, fatty acids are stored as triglycerides in cells with Golgi that store fatty acids.…

Q: Which of the following hypothetical islands would likely have the greatest species richness?

A: Biodiversity, often known as biological diversity, refers to the variety of life that can be found…

Q: The origin of the photosynthetic eukaryote took place when a engulfed by a later eukaryote with…

A: Two organelles - Mitochondria and Chloroplast have their own separate DNA and ribosomes. The DNA in…

Q: #1 3. Explain how this relationship between the solution and the Elodea cells (from #1) caused what…

A: When compared to the intracellular solute concentration, an isotonic fluid has the same solute…

Q: Tell me how this image shows the relation between grape and banana

A: A phylogenetic tree's branching structure illustrates how many species or other groupings developed…

Q: a. Explain the purposes of tissue fixation and tissue staining. b. Identify the factors that affect…

A: In this answering session the questions a and b will be addressed, as rest of the questions are…

Q: The evolution of the highly complex eukaryotic cell was possible because.. A) Mesosomes released…

A: Correct answer is (B). Two different prokaryotic bacterial species entered the complex cells as endo…

Q: .What is biomass as a source of energy? Is it considered as renewable source of energy?

A: Biomass energy is the energy which is generated by using living mass.  Biomass is a renewable energy…

Q: Explain how Ethnic Origin (regional ancestry) can be determined from bone but not “Race”. Explain…

A: Answer : Ethnic Origin (regional ancestry) can be determined from bone but not “Race” by clearly…

Q: In a population of 643 mice, 124 had white coat colour (a recessive trait) while the rest had black…

A: Random mating occurs when individuals in a population mate with other individuals in the population…

Q: ACTIVITY 2: Protein Synthesis DNA: 3' A G C C G T A GA AТТ 5' 1. Using this strand of DNA as a…

A: Cells create proteins through a mechanism known as protein synthesis. Transcription and translation…

Q: What is a ciliary escalator and why should I care? What would be the consequences if it is not…

A: When we breathe, the lungs exchange oxygen from the air for carbon dioxide waste from the blood.…

Q: . Magnifying Procedure lens 1. Look at the live specimen shown by your teacher which is like the…

A: The method that biology categorizes living things in accordance with their evolutionary lineage is…

Q: he next several questions refer to the data given in this problem. You sample a population of…

A: Hardy-Weinberg equilibrium is a principle in population genetics that states the frequencies of…

Q: describe the IR spectra pattern of ascorbic acid (Vitamin C)

A: Analysing Infra Red (IR) spectra of any compound provide an idea about their identification through…

Q: DNA is alway DNA mRNA 5' aal 3 51 PROMOTER AACGCATACGGGATAGCGCCCTGGTTCAAATGGCGGGCCGGCATCCC…

A: One of the core concepts of molecular biology is the flow of information from DNA to RNA to…

Q: Are humans different on a species level? only a few somewhat no yes

A: The scientific name of human is: Homo sapiens. It belongs to Mammalia class in chordates. The human…

Q: In eukaryotes, Cot DNA reassociation curves are not smooth. They have bumps. Why? What are the…

A: Genome of an organism can be defined as a sum total of all the genetic material present in it.Genome…

Q: B. Next you isolate DNA from colonies and cut the DNA with the restriction enzymes you chose from…

A: A. As the plasmid contains ampicillin resistance gene, therefore, it confers resistance to amicillin…

Q: Use arrows to identify the transition of the type of epithelium, esophageal glands and gastic glands…

A: The stomach is a J-shaped organ in human body that helps in digesting food. It produces enzymes and…

Q: A blood sample is drawn in NaCitrate. The platelet count on an automated instrument is 305,000/UL.…

A: A platelet count from blood drawn into a sodium citrate tube is multiplied by 1.1 to account for the…

Q: Is ALS inherited? If so, what is the mode of inheritance (i.e. sex-linked, autosomal recessive,…

A: In familial cases, ALS can be inherited — that is, passed from parents to their children. For the…

Q: The following structure is ATP synthase. Which of the following statements is NOT true for the ATP…

A: The respiratory chain generates an electrochemical gradient of protons (or sodium ions), which the…

Q: IPTG (isopropylthiogalactoside) is commonly used to induce protein expression in Lac…

A: IPTG, also known as isopropyl d-1-thiogalactopyranoside, is a molecular biology tool. This substance…

Q: Put the steps of the process of signal transduction in the order they occur (hint - try to decide…

A: The receptors have site for binding of specific ligand. The receptors are of two types: Membrane…

Q: What are some benefits that come with sexual reproduction? Please select all correct answers. a.…

A: Reproduction is a biological process possessed by living organisms to promote their number in nature…

Defense Mechanism

Circumstances influence and compel people to behave in a certain way. One such behavior is a defense mechanism. It is employed by people to escape from unpleasant circumstances, thoughts and actions. Defense mechanisms are, thus, psychological strategies that help to avert and avoid unwanted feelings such as guilt or shame and situations such as threat and danger.