Q: HO HH C-N-C -C- OH R +H20 H H C-N-C N-C OH OH H. R. The chemical reaction illustrated in the…
A:
Q: Heat-sensitive film, which captures the body temperature of organisms on film, is used to photograph…
A: Homeostasis refers to the process of maintaining internal physiological parameters in a changing…
Q: Create a table comprising example and features from Domain to common name. Create 1 table for each…
A: Taxonomy is the branch of science that deals with the name, description, and classification of all…
Q: The mating below shows the sex chromosome found in two parents and their resulting offspring. FMR1…
A: Introduction An organism's genotype is its entire set of genetic material. The alleles or variants…
Q: To explain: The way in which the plants with nodules for nitrogen-fixing bacteria might…
A: Nitrogen fixation is the process through which atmospheric nitrogen is converted to ammonia through…
Q: This type of fertilization happens when the sperm is introduced inside the female body through…
A: The process of fusion of sperm with egg (ovum) to produce zygote is called fertilization.
Q: What are some changes in the brain that occur in someone with major depression? Describe both…
A: In several cases, the person under depression found to have shrinked brain. The gray matter volume…
Q: 30-40% of all type 1 DM patients develop nephropathy in years
A: Diabetes can cause diabetic neuropathy, which is a kind of nerve injury. High blood sugar (glucose)…
Q: Quarter Activity 4 Instructions Instructions Direction: Answer the following questions in paragraph…
A: 1) Body system: A collection of parts able to work together to serve a common purpose- growth,…
Q: European cuckoos and North American brown-headed cowbirds are not close relatives, but both lay…
A: Animal behavior is heavily influenced by the environment to which it belongs. If they do not fit in,…
Q: How much of 9XTBE (in ml) and how much water (in L) do you need to prepare 2 L of 1XTBE? I need I…
A: Given, 9xTBE and water. We need, 2L of 1xTBE solution. We will use the formula, M1V1 = M2V2 M1 and…
Q: Activity 2: Give examples of different species of animals that can be found in different parts of…
A: Biogeography is the study of the geographical distribution of the living forms of life like plants…
Q: Pyruvate from glycolysis is oxidized by ATP. in the mitochondrial matrix. a. b. to release water. C.…
A: Aerobic respiration :- it is the process of cellular respiration that takes place in presence of…
Q: QUESTIONS FOR RESEARCH AND PROBLEMS 1. Give the major factors that cause changes in the genotype and…
A: The complete set of genetic material in an organism is known as genotype. It can also be referred to…
Q: What is the specific molecule recognized in our ELISA to measure phospholipase C activity? How is it…
A: Snadwisch ELISA method can be to measure phospholipase c activity can detect the level of PLCG2…
Q: Choose which does NOT belong to the group then give the commonality of the remaining 3 terms 1.…
A: In plants; each part have different roles to play for the proper development of plants.
Q: In a canine expt, a dog’s filtered load of sodium (Na+) in an isolated pump-perfused kidney is found…
A: Given: Filtered sodium Na+=15 mmol/min To find: To find the volume of Na+ that remains in the tubule…
Q: What is the advantage, if any, of direct development in gnathostomulids? 2. What are the…
A: Gnathostomulids is the marine worm while rotifers are multicellular organism.
Q: Dropping Mercury Electrode
A:
Q: You are a scientist studying the relationships between lizards, penguins, and parrots. You examine…
A: The trait no body temperature regulation is found in al common ancestors and hence will be a…
Q: What is Mutation 2? a) Synonymous b) Read through c) Nonsynonymous d) Nonsense Mutation 2 ATA…
A: Mutations are sudden heritable change in the DNA sequence that alters the amino acids and then the…
Q: What are 4 beneficial (mutualistic) and 4 harmful (antagonistic) interaction between two or more…
A: Beneficial mutualistc interaction improve agricultural production or food production... 1. The…
Q: The elderly tend to have difficultly absorbing vitamin A with age. O a) True b) False
A: Vitamins are the organic compounds which are required by our body in small amounts for maintaining…
Q: What is the name of the process by which bacteria pick up a different organism’s genetic material?
A: 4. A bacterium takes up a fragment of DNA circulating in its surroundings during transformation. A…
Q: What are 4 mutualistic and 4 antagonistic interaction between two or more species that are exploited…
A: Four mutualistic interactions- 1. Aphids and ants- Aphids are sap-sucking insects that exude…
Q: To explain: Whether humans are dominant species or key ştone species.
A: A species is a group of organisms with genetic similarities, the ability to interbreed, and thus the…
Q: owl, barring (B) is sex-linked and dominant, the recessive allele (b) producing solid black color…
A: Sex linked character is usually present on the sex chromosomes which are either in the form of x or…
Q: Question - What is biology? A) The study of DNA. 3) The study of the environm C) The study of life.…
A: Science is the intellectual and practical activity encompassing the systematic study of the…
Q: bacteria
A: Auxotrophic strains lack the ability to synthesize one essential compound for example amino acid.…
Q: How hormones affect different classes of vertebrate?
A: Hormones are chemical substances that act like messenger molecules in the body.
Q: ACP is specific of the pancreatitis O True O False is defect inglucuronyl transferase O Gilbert…
A: Acute pancreatitis is a pancreatic inflammatory illness that can occur all at once or in relapses.…
Q: AC CAG CCC AAG ATT ____________ Transcription: Translation:
A: The flow of genetic information in a biological system is explained by central dogma and it involves…
Q: nscript: 3' TACAGTTAAGGCTCCACTGTTA 5' 5' 3' ino Acid Sequence (ex. Met-Trp- and so on) Second letter…
A: The genetic code is the relationship between the sequence of bases in DNA and the sequence of amino…
Q: The joining of male and female reproductive cells is called?? II. It is the make reproductive part…
A: Plants' life cycles comprise two stages called alternation of generations. The haploid gametophyte…
Q: . Another mutation changes the insulin gene to read TCT (instead of the normal TA G). Will this…
A: Yes he became diabetic.
Q: define both selective and enrichment media as they may be used in clinical microbiology
A: Media in microbiology or also known as bacterial culture media. It is a growth medium used to grow…
Q: C-A-G-T-T-A-A-G-G-C-T-C-C-T-A-G-G-T-T-A 5' i. What would be the first 5 bases at the 3' end of the…
A: 3' C-A-G-T-T-A-A-G-G-C-T-C-C-T-A-G-G-T-T-A 5' Complementary strand- 5'- CTCAATTCCGAGGATCCAAT-3' i)…
Q: 43) Topic of Lipids A second big category of lipids are isoprenoids. What are three precursors to…
A: Isoprenoids are a broad class of natural products commonly found in plants and other living beings.…
Q: 9. Coronary arteries route oxygen rich blood into the tissues of the heart. They branch off of the:…
A: As per our honor code, we are allowed to answer only one question at a moment. You have posted…
Q: CLASSIFICATION EXAMPLES FEATURES Domain Archaea Kingdom Phylum Class Order
A: The largest and broadest category of all groups in the classification of life is known as domain. At…
Q: As it applies to biological systems, the second law of thermodynamics indicates that: O If left…
A: The energy transfer is not 100 percent efficient, much like other biochemical functions. In…
Q: 4. The difference in charge between the outside and the inside of a neuron at rest is called: A.…
A: Introduction Membrane potential:- It is a potential gradient that forces ions to passively move in…
Q: Gamma globulins is synthesized in the liver True false plasma lipid is synthesis in the Kidney liver…
A: Please follow steps 2, 3 & 4 for detailed explanation.
Q: What are the importance tof ants o other organisms and to the environment
A: The ant is one of the world's most strongest animals comparable to its size. A single ant can carry…
Q: 3. In excitable cells, depolarization is most closely associated with which of the following events?…
A: INTRODUCTION A neuron is the basic functional structure of the central nervous system. Neurons are…
Q: Give the PLOIDY of the following (ex: haploid, diploid, etc…) 1. oospore 2. prothallus 3. androcyte…
A: Ploidy can be defined as a total number of sets of chromosomed present in a nucleus of a cell.…
Q: Question 30 a co-immunoprecipitation experiment is shown comparing cancer and non- cancer cells,…
A: 30... Western blot Western blot work on enzyme-linked immunosorbent assay principle, The Western…
Q: On average, about how many bird species were present in this forest plot before fragmentation? How…
A:
Q: List two types of multifactorial inheritances and explain them.
A:
Q: The probability of having an individual with a least a heterozygous gene pair on its genotype from…
A: The two genes are involved in this case. That's why it is a case of dihybrid cross.
Would you expect all EIDs to be on the notifiable infectious disease list? Explain.
Step by step
Solved in 2 steps
- Pathogenic microbes that cause disease in health care settings fall under which category of organisms? O 1) Normal flora O 2) True pathogens O 3) opportunists 3) O 4) NosocomialWhy is it important to calculate disease rates to report disease outbreaks accurately?of the federal agencies that regulate epidemiological risk; which one allows more risk, OSHA or the EPA? why?
- In relationship to infectious diseases, Identify errors as either systematic or random. Give examples.Identify the following scenarios as either endemic, epidemic, or pandemic disease or classify descriptions as either primary, secondary, or tertiary prevention. Physical therapy for stroke patients Exercise to prevent obesity In 2009, the H1N1 strain of the flu spread to several countries Annual lung cancer screening among older adults who are long-term smokers Unvaccinated travelers to Mexico are at risk of contracting hepatitis A because of the regular presence of this disease in the area. A. Endemic B. Epidemic C. Pandemic D. Primary prevention E. Secondary prevention F. Tertiary preventionOn the list of controlled diseases in South Africa (Animal Disease Act): In a table format give the motivation why they have been considered as controlled diseases, location of prevalence in South Africa, using the OIE and other publications and also the regulations in South Africa: 1. what are the individual actions that a) an Animal Health Technician, b) State Veterinarian c) Private Veterinarian d) the state or DAFF can play during the control (prevention and during outbreak) for each diseases
- If a disease X has a duration of 15 years and a low incidence (5 per 100,000 person-years). If another disease Y has a duration of 5 years and a low and low incidence (5 per 100,000 person years). If we compare disease X and Disease Y in the same population, we would expect: a) Better cure b) lower prevalence c) higher prevalence d) Higher incidence e) shorter durationAt the beginning of the COVID-19 Pandemic, the Department of Health used a graph to represent the prediction of the number of active cases, if no interventions were made. The vertical axis gives the number of active cases and the horizontal axis shows the number of days since the start of the pandemic. Pennsylvania residents were asked to quarantine to flatten the curve of the graph that rep- resented the number of active infections. Which of the following statements are true? Select all that apply. A Flattening the curve would represented a vertical compression of the graph of the data. B Flattening the curve would be a horizontal stretch of the graph of the data. When reading statistics reported in reputable news sources, it is beneficial to under- stand data measurement vocabulary. UDiscuss the three major types of epidemics, and identify the epidemic curve associated with each.
- Make a Critique report about "INTERDISCIPLINARY RESEARCH APPROACHES TO EMERGING PATHOGENS OF DISEASES OF THE GLOBAL HEALTH CONCERN." Can use this as basis: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3586606/Using the knowledge acquired in primary health care media rapportage, discuss the relevance of the following in containing the disease Covid-19 in your community. I) hand washing with soap under running water.(provide supporting references). ii) hand sanitizing (provide supporting references) III) self-isolation (provide supporting references) iv) social distancing (provide supporting references).Observe the following maps (a)–(c) of three diseases. Determinewhich show endemic, sporadic, or epidemic pattern, and explain whatfeatures have helped you to make this decision.