Answered: 1.How can we explain the near universal…

1.How can we explain the near universal use of the genetic code between bacteria, archaea and eukarya? 2. How did scientists crack the genetic code? Describe the experiment in your own words

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 4TYK

See similar textbooks

Related questions

Q: Mark 133. A male newborn has anemia and jaundice. A peripheral blood smear shows variable…

A: Reticulocyte count means amount of effective RBC production taking place in bone marrow. Normal RBC…

Q: Which of the following statements are characteristics of the aerobic respiration method of making…

A: Please follow step 2 for detailed explanation.

Q: Retrograde and anterograde transport occur in the dendrites cell body (soma) axon axon hillock

A: Axonal transport is a physiological process that transport proteins and other substances synthesize…

Q: Compare the structure, location, and function of DNA and RNA in a chart below

A: DNA is a is normally been described that it's far the molecule this is decided withinside the…

Q: L Larvae and pupae per Bt plant 100 10 0.1 TO -- Mosaic, Cry1Ac plant --0-- Mosaic, Cry1C plant --…

A: Cry 1Ac plant shows stop at 12 generation.

Q: Natural Selection causes: * Mark only one oval. Changes in the environment All plants and animals to…

A: Introduction Natural selection:- It is a phenomenon in which organisms possessing favorable traits…

Q: Identification and quantification of expressed genes initially requires a. reverse transcription of…

A: Gene is a basic unit of heredity and a sequence of nucleotides in DNA that encodes the Synthesis of…

Q: Question 1 Select one answer. Which of the following is not a mechanism used by aldosterone to…

A: Aldosterone is the corticosteroid hormone secreted by the adrenal gland. Plays a major role…

Q: When looking at a stained cell under a high power light microscope, can one distinguish between the…

A: Introduction Chromosomes are threadlike structures made up of protein and a single molecule of DNA…

Q: Explain how the disease effects the conduction of information and what class of neurons appears to…

A: Multiple sclerosis has no recognised aetiology. It's classified as an autoimmune illness since the…

Q: Identify the 4 components needed to start a PCR reaction (equipment not included)

A: A basic PCR set up requires the following essential components and reagents- 1. Template DNA…

Q: What are the advantages and disadvantages of self and cross pollination?

A: To ensure their viability and generation of species, the plants go through various modes of…

Q: What are some similarities and differences in Bradford assay and Nanodrop (to obtain direct…

A: Protein quantification assays and their benefits and setback.

Q: Biology 1. Which statement(s) is/are most correct concerning the history of epidemiology: a. The…

A: Epidemiology The study and analysis of the occurrence, trends, and causes of health and disease…

Q: Question 7. How might one test whether the differences in moth density in the two types of plants…

A: Answer :- When sent consistently in the field, hereditarily controlled plant obstruction is…

Q: An undergraduate researcher in your lab is studying mutations affecting the wings of Drosophila…

A: Alleles of homozygous bent-winged fly which possesses the normal allele of apterous: ap+be, apbe…

Q: In a newly discovered species of Giant Pacific Octopus, long tentacles (L) are dominant to short…

A: Newly discovered species of Giant Pacific Octopus having long tentacles, strong suction cups and…

Q: I || 1 1 2 2 O 3 1 2 4 3

A: As per our guidelines we are not allowed to answer 3 sub parts at a time please ask rest of the…

Q: What will be the complete hydrolysis products of the given structure below? CH₂-0-C-C17H37…

A: Given structure is a phosphatidylcholine (PC) It belongs to the class of phospholipids that has…

Q: Two gene loci, A and B, are on separate chromosomes and alleles A and B are dominant over alleles a…

A: Dihybrid cross Is a mating experiment involving two creatures that are genetically identical in two…

Q: Many dairy operations keep cow’s milk for sale and use formula to raise any calves. The farmer…

A: Calf Diarrhoea is also known as scours, is a conditions that can be caused by many different factors…

Q: what happens to skeletal muscle if there is no ATP present but plenty of calcium. Be specific…

A: Sliding filament theory is the most widely accepted explanation for muscle contraction. It states…

Q: Define and compare a bacteriophage lytic cycle and lysogenic cycle.

A: ANSWER) Lytic cycle of bacteriophage is the cycle in which the cellular mechanism on the host cell…

Q: Define Hilum.

A: In botany Hilum is a structure related to seed, it is found on the seed of a plant mainly. In a…

Q: Question: A second trihybrid test cross was performed involving female octopus that were…

A: Answer :-

Q: How many binding sites are uncovered for each molecule of troponin that binds to calcium

A: Introduction:- In muscular contraction, calcium plays a vital regulatory role. Its presence in a…

Q: Tailless non-human primates are commonly called

A: Introduction: Nonhuman primates are mammals that include both simians (monkeys and apes) and…

Q: 1. Given the following restriction endonucleases and the sequences of their corresponding…

A: Prokaryotic cells are unicellular organisms that differ from multicellular organisms in composition…

Q: As diagrammed below, some amino acid biosynthetic operons have stem loop structures in the mRNA.…

A: Option A is incorrect as without the formation of heparin the process of translation can not be…

Q: Which two traits on the gene map below for the fruit fly are most likely to cross over together?

A: The physical crossing over during meiosis of parental heterozygous homologous chromosomes or genes…

Q: Microscopes Assignment

A: as per our company guidelines we are supposed to answer only first 3 question. Kindly repost other…

Q: Zoology experiment: The Predator-prey Interactions Between Zebrafish and Daphnia 1. Six 1-L beakers…

Q: When a very strong stimulus initiates an action potential, the response is: I. a longer-duration…

A: Anything that causes an animal or a section of an animal to respond in a way is referred to as a…

Q: Within a cell, the complete breakdown of glucose to generate ATP occurs by two fundamentally…

A: Ques : Within a cell, the complete breakdown of glucose to generate ATP occurs by two fundamentally…

Q: What is your stand regarding recombinant DNA technology? Give valid reasons why you think the way…

A: Recombinant DNA is the method of joining two or more DNA molecules to create a hybrid.

Q: Topic: Species and taxonomic system. Fill the blank 6. A group of related families are in the…

A: In biology, taxonomy is the scientific study of naming, defining and classifying groups of…

Q: You are conducting independent research for your Honors Thesis in a Drosophila research lab. One of…

A: Let's represent the gene of scarlet eyes with 's' and the gene for brown eyes with 'b'. Parents :…

Q: . A population called the founder generation, consisting of 2000 AA individuals, 2000 Aa…

A: Hardy Weinberg law : It states that both the gene frequency and genotype frequency will remain…

Q: Question:- 7. How do electrons interact with biological specimens? Advantages and disadvantages.

A: "All living organisms are made up of cells, which are the basic building components." They support…

Q: Jessica was trying to solve a problem given to her in class. Help her figure out which produces more…

A: Excretion is defined as the removal of waste products outside the body. The excretion process is…

Q: Early in the digestive process, a digestive enzyme found in saliva called ptyalin breaks down large…

A: Introduction:- Enzymes are proteins that aid in the speeding up or slowing down of the metabolic…

Q: 14. Female gonads that produce eggs and the female sex hormones. About 3 cm by 1cm in size 15.…

A: 14) Ovary : these are female primary sex organs and here oogenesis or process of formation of female…

Q: 1. Do we need identical clones of the extinct animals or should we explore inserting genes to make…

A: "Biotechnology" is the use of our knowledge of biological processes for the development of…

Q: Identify possible etiologic agents. (a) Enumerate diagnostic tests for the said etiologic agent…

A: Etiologic Agents are pathogens or infectious organisms that need special attention. They are often…

Q: b. Right side 4. Wastes like excess water and salt are excreted through the pores of which organ a.…

A: Kidney is a part of excretory system. It is bean shaped on either side of spine. Disclaimer -…

Q: Globular cells are said to be spherical. When slightly flattened, they are disc-shaped. Squamous…

A: Ques : What is the shape of the cartilage cell(1), bone cell(2), and cardiac muscle(3) specimens?…

Q: efer to the table below: Saponification Number 179 260 193 185 lodine Number 102 10 111 79 Oil…

A: Introduction Iodine number defined as the number of grams of iodine that are consumed by 100 gram…

Q: What is role of insulin in human body?

A: Introduction Glucose is the main source of energy and the simplest carbohydrate which is present in…

Q: likely to happen if there are any errors during thae gastrulation stage

A: Embryo development The embryo develops in 4 major stages which are, fertilisation cleavage…

Q: Why is it advantageous to have multiple steps during a signal transduction pathway? It allows fine…

A: The signal transduction pathway refers to the binding of intracellularly signaling molecules and…

Concept explainers

Genetic Evolution

Sexual reproduction produces distinct population variations. Heredity determines the traits and qualities to be passed down to the progeny. Over time, this variation within-species is also affected by the process of human evolution. The study of how genetic variation leads to evolutionary changes is known as genetic evolution. If a trait helps an organism to survive and reproduce, it is more likely to be passed down the generations. It is rare that such traits result in a completely distinct set of traits in descendants than the ancestral population; this can result in the emergence of a new species.

Question

1.How can we explain the near universal use of the genetic code between bacteria, archaea and eukarya?

How did scientists crack the genetic code? Describe the experiment in your own words.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

1. How are bacteria used in genetic engineering to produce medicine for people? 2. How is recombinant DNA technology used in medicine?
4. What is the name of the process by which bacteria pick up a different organism’s geneticmaterial?5. Genetically, how does the original bacterial DNA (plasmid) differ from the final bacterial DNAmolecule? (Do not say, “It is longer.”)6. Tetracycline is an antibiotic that is prescribed to kill bacterial infections. The transformedbacterial cell that you created has the tetracycline resistant gene in it. If this cell is placed on agrowth medium with tetracycline, will the bacteria grow or die? Explain.
2. How does the universality of the genetic code make the recombinant DNA technology possible?
3. Compare and contrast the contributions of the following two biologists. What would be the effect on science as a whole if these biologists did not exist? Rosalind Franklin Rosalind Elsie Franklin (25 July 1920 - 16 April 1958) was an English chemist and X- ray crystallographer whose work was central to the understanding of the molecular structures of DNA, RNA, viruses, coal, and graphite. Although her works on coal and viruses were appreciated in her lifetime, her contributions to the discovery of the structure of DNA were largely recognised posthumously. Franklin is best known for her work on the X- ray diffraction images of DNA, particularly Photo 51, which led to the discovery of the DNA double helix for which Francis Crick, James Watson, and Maurice Wilkins shared the Nobel Prize in Physiology or Medicine in 1962. After finishing her work on DNA, Franklin led pioneering work at Birkbeck on the molecular structures of viruses. Her team member Aaron Klug continued her research,…
1. WHY DO WE NEED GENETIC ENGINEERING?
2. Who are the scientists that proved DNA is the transferrable genetic material and Discuss how they proved based on their experiment?
5. You imagine that not all life forms (including viruses and aliens) must have double stranded DNA molecule as their genetic material. Theoretically, a genome can be made of single stranded DNA, single stranded RNA, double stranded DNA, double stranded RNA and a double stranded hybrid of DNA/RNA. Which type of genomes do the following organisms have? a) Genome = 15% G, 0%T, 15%C, 35%U, 35%A b) Genome = 31%G, 19%T, 31%C, 0%U, 19%A
6. Examine the following coding strand DNA nucleotide sequence,^representing the complete gene sequence (i.e. control elements + RNA-coding sequence) of a bacterial gene. Answer the questions below by using the list of consensus sequences and the genetic code. 5' CGCTCAGAAAATTATATTAAATTTCCTCTTGACACTCGCTTTCGTGATCGTCTTATAATGTGTGGATG CCGAAAACGACAATTTCTGACTTACCGGGGTTTTAAGGAGGTAATATGCAAATTAGCGATACCGGCC GCAGCCACACTCCTGACTTTCACGCCTAGTCGCCCGTGAAGACTGGCACAACCAGACCATTACCCACC TTAACCGCCTGCCAGCGCATCCCGTTTTCGCCAGCTGGCGCGATGAGCTTGCCGCCCGCGATTCAGCC CGCGTAGTAAGCGGGCTTTTTTTGGGAGTGGCAGTTCTCTTACGCCCGCAGCCCG 3' Clearly indicate the following directly on the DNA sequence above: promoter elements - underline and label as (a). the sites for initiation of transcription - use an arrow V and label as (b). the sites for termination of transcription – use an V arrow and label as (c). d. Give the sequence of the first 10 nucleotides of the mRNA transcript 5' to 3'. a. b. С.
1. Many scientists were involved in the experiments to determine the genetic material. For each of the research groups, list the major conclusion and a major tool (or living system) used to do the work. Terms may be used once, more than once, or not at all. X-ray crystallography Strep. pyogenes bacteria (rough and smooth) DNA is a molecule with a sugar phosphate backbone and nucleotide bases as rungs Griffith Avery, McCarty McLeod, Hershey & Chase Chargaff Crick, Watson, Franklin, Wilkins Major Finding DNA is the heritable material %A=%T and %G=%C Genomes of various organisms Genetic material is heritable DNA is the heritable material Research "tool" Strep. pyogenes bacteria (rough and smooth) Bacteriophage
1. Use the prokaryotic gene DNA sequence below to answer the following questions: 1 11 21 ATGAAGCTAC 51 TTTGCCCAGG 101 61 TTTGACAGTC TTCTATCGAA CAAGCATATA ATCAGCGATA 111 71 31 121 AGGTTTAACA ACATGTCAAG TGCTCCAAAG AAAAACCGAA d. Where is the 3' UTR? Circle one. 12-72 35-72 81 131 109-146 41 ACATCTGACA GGGAAAAAAT CCCCCCCCCC TTTTTTTTTT TTTTTTCCCG 91 a. Write the corresponding sequences, circle & label them in the sequence above: -35 consensus sequence: (label as -35) -10 consensus sequence (Pribnow box): Shine-Delgarno sequence in the corresponding mRNA:_ Start (initiation) codon in the corresponding mRNA: Stop (termination) codon in the corresponding mRNA:_ (label as PB) 141 (label as SD) (label as start) b. What region of this prokaryotic DNA sequence will be transcribed into mRNA? Circle one. 1-120 35-108 54-146 72-146 c. What will be the nascent polypeptide sequence translated from this mRNA? 121-146 (label as stop)
1. In the Hershey-Chase experiments, why was DNA labeled with radioactive P and protein with radioactive S? Why not use radioactive carbon for DNA and radioactive nitrogen for protein? Those elements are more abundant in the cells. 2. If Hershey and Chase had picked an RNA virus as their bacteriophage, would the results of their experiment changed? Why or why not?
8) Which of the following best describes why it is possible for the bacteria to read the instructions in a human gene and produce a human protein as a result? Bacterial cells and human cells are identical and contain the same organelles Bacterial cells and human cells both use DNA to store their genetic information The genetic code is universal - the same codon codes for the same amino acid in all species The bacterial cell already contains a gene that is very similar to the human growth hormone gene