Microbiology: A Systems Approach
5th Edition
ISBN: 9781259706615
Author: Marjorie Kelly Cowan Professor
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 4, Problem 1VC
Summary Introduction
To determine:
Whether the bacteria spelling “Klebsiella” or the bacteria spelling “S. aureus” possess the larger capsule.
Concept introduction:
Differential media allow multiple organisms to grow at the same time but are designed to display visible differences among their colonies. The difference can be due to colony color, media color, colony size, formation of gas bubbles or precipitation.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
A colony of spherical bacteria which are in a cluster are classified as:
Question 26 options:
staphylococcus
streptococcus
vibrio
diplobacillus
What are some characteristics of Clostridium difficile that contribute to the pathogenicity of this bacteria?
Question 11 options:
Ability to form spores
Gram +
long term antibiotic therapies
all of the above
QUESTION 10
You grow this weird looking organism in lab and have no idea what it is. You decide to sequence its genome and one of the reads you get back is shown below:
>UnknownSequence1
GCGGTATTTGACGCCGCATTCGAAGTGGTCGATCCATTCGGCGTATCAGGACAATTTGCATATGTTGACGTTGTCGCGGGGTGGGCCCTCGATCTGGATGTCGGAGCGGGACGCG
GCGAAGATCGGTGTGGCCGATAATGATTGGATCGAGGCGGTCAATCGTAACGGGGTGGTGGTGGCGCGGGCGATCGTGT
Chapter 4 Solutions
Microbiology: A Systems Approach
Ch. 4.1 - List the structures all bacteria possess.Ch. 4.1 - Identify at least four structures that some, but...Ch. 4.1 - Prob. 3AYPCh. 4.1 - Prob. 4AYPCh. 4.1 - Provide at least four terms to describe bacterial...Ch. 4.2 - Describe the structure and function of five...Ch. 4.2 - Prob. 7AYPCh. 4.3 - Prob. 8AYPCh. 4.3 - Prob. 9AYPCh. 4.3 - Prob. 10AYP
Ch. 4.4 - Prob. 11AYPCh. 4.4 - Prob. 12AYPCh. 4.5 - List some differences between archaea and...Ch. 4.6 - Differentiate between Bergeys Manual of Systematic...Ch. 4.6 - Prob. 15AYPCh. 4.6 - Define a species in terms of bacteria.Ch. 4 - Which of the following is not found in all...Ch. 4 - Pili are tubular shafts in ____ bacteria that...Ch. 4 - Prob. 3MCQCh. 4 - Which of the following is a primary bacterial cell...Ch. 4 - Which of the following is present in both...Ch. 4 - Darkly stained granules are concentrated crystals...Ch. 4 - Bacterial endospores usually function in a....Ch. 4 - A bacterial arrangement in packets of eight cells...Ch. 4 - Prob. 9MCQCh. 4 - Prob. 10MCQCh. 4 - Prob. 11TFCh. 4 - A research microbiologist looking at evolutionary...Ch. 4 - Nanobes may or may not actually be bacteria.Ch. 4 - Both bacteria and archaea used to be known as...Ch. 4 - Prob. 15TFCh. 4 - Define the term ubiquitous and explain whether...Ch. 4 - Quorum sensing is a process used by many bacteria...Ch. 4 - Based upon your knowledge of cell wall structure,...Ch. 4 - Provide evidence in support of or refuting the...Ch. 4 - a.Describe the characteristics of an...Ch. 4 - Prob. 1VCCh. 4 - From chapter 1, figure 1.14. Study this figure....Ch. 4 - Prob. 1CM
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Match the following with the choices on the right Bacteria 1. Eukaryotic photosynthetic organisms that are not plants 2. Nucleic acid in a protein coat 3. An infectious particle that is a protein Archaea Fungi Protozoa Algae Platyhelminthes Nematoda Viruses Viroids 4. Prokaryotes, usually with peptidoglycan Prions cell wallsarrow_forwardWhat is the proper description of the shape and arrangement of the bacteria in this picture? Streptobacillus Streptococci Staphylococci Tetrad ASM MicrobeLibrary.org Smith Palisadearrow_forwardCASE #2 A 25-year-old Peace Corps worker has just returned from service in Ethiopia. She experiences a sudden onset of asthma-like symptoms. She has no previous history of asthma. An O & P (ova and parasites) on her stool was part of the normal discharge physical, considering the area of assignment, before being released from the Peace Corps. The sample was processed according to standard laboratory procedures. Two suspicious structures were noted during the direct saline wet preparation. The first of the two structures is noted in form # 1; it measures 50 x 40 um. The second structure is depicted in form #2 and measures 18 um in diameter. Form 1 Form 2 1. Which of the structures is (are) considered a pathogenic parasite(s)? Do the presenting symptoms relate to the O & P findings? If so, explain. Look at the structure depicted in form #1. What key characteristics allow you to identify the organism? Name the organism and its stage. 2. 3.arrow_forward
- Fill in the blank: The bacterium Staphylococcus aureus is ___________ in shape and ______________ in arrangement.arrow_forwardHow do I go about drawing a biological drawing of Sarcina lutea? Apparently it has been reclassified as Micrococcus luteus, and I have found an image for me to base my drawing on (image attached), but I don't exactly know which parts to label. Hope I can get some help on this.arrow_forwardMatch the description listed below to the correct bacterium. Grows in intestine of ruminants like cows. [Choose ] Can be found in raw milk. If ingested, can cause spontaneous miscarriage in women, neonatal sepsis and meningitis [Choose ] Listeria monocytogenes_ Can grow in high salt environments. Makes a Staphylococcus aureus_ heat stable enterotoxin Campylobacter_ When the toxin this pathogen makes is _Vibrio cholerae_ ingested, can cause "projectile vomiting" Streptococcus pyogenes_ Can grow as a mesophile in humans, but also can grow as a psychrophile in refrigerators [ Choose ] A leading cause of food-borne infections, grows on fecal contaminated raw poultry (e.g. raw chicken), forming a biofilm. A [Choose ] microaerophile Question 41 How can Clostridium tetani survive in aerobic environments?arrow_forward
- Description Shape: Arrangement: Photo by 1000x MITPanganiban Figure 2.9. Microscopic morphology of Bacillus cereus. Description Shape: Arrangement: Photo by 1000x MITPanganiban Figure 2.10. Microscopic morphology of Staphylococcus aureus..arrow_forwardwrite out a detailed summary on E.Coli. Questions below will help yu frame your summary. Please describe the bacterium. What is its shape and size? Is it Gram-positive or negative? Pictures are always fun! If you can find a microscopic image – include it. What is/are the reservoir(s)? e.g. water, food, human, etc. Are there parameters needed for infection? (Temperature, pH) What is/are the mode(s) of transmission. If it's foodborne - is it linked to a specific food? How many cases occur each year? In the US and/or worldwide and/or in the County where you live Has it caused any outbreaks or epidemics? Thank you-arrow_forwardThe rough strain of Streptococcus pneumonia is not pathogenic because it lacks the present on the pathogenic smooth strain of Streptococcus pneumoniae. cell wall O endospore capsule gas vesicles peptidoglycan flagellumarrow_forward
- The microbiology department is celebrating the end of the school year in May by holding its traditional picnic on the green. The speeches drag on for a couple of hours, but finally all the faculty and students can dig into the food: chicken salad, tomatoes, onions, salad, and custard pie. By evening, the whole department, except for two vegetarian students who did not eat the chicken salad, is stricken with nausea, vomiting, retching, and abdominal cramping. Several individuals complain of diarrhea. One patient shows signs of shock (low blood pressure). Blood and stool samples are collected from patients, and an analysis of all foods served at the meal is conducted. Bacteria can cause gastroenteritis (inflammation of the stomach and intestinal tract) either by colonizing and replicating in the host, which is considered an infection, or by secreting toxins, which is considered intoxication. Signs and symptoms of infections are typically delayed, whereas intoxication manifests within…arrow_forwardWrite a paragraph for when you once have Neisseria gonorrhoea bacteria in its pure form, what methods can you use to confirm the identity of this bacterium as N. gonorrhoeae? Mention what is the principle of those methods.arrow_forwardBacteria whose colonies grow in long chains of spherical cells are classified as___. staphylococcus vibrio streptococcus diplococcusarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Mechanisms of Pathogenicity: Microbiology; Author: Dr. Frank O'Neill GrowGrayMatter;https://www.youtube.com/watch?v=SDyl0JNCeho;License: CC-BY