Fundamentals of Anatomy & Physiology Plus Mastering A&P with eText - Access Card Package (10th Edition) (New A&P Titles by Ric Martini and Judi Nath)
10th Edition
ISBN: 9780321908599
Author: Frederic H. Martini, Judi L. Nath, Edwin F. Bartholomew
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 3, Problem 7RQ
The synthesis of a functional polypeptide using the information in an mRNA strand is (a) translation, (b) transcription, (c) replication, (d) gene activation.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
The RNA synthesized on one of the DNA strands is (a) mRNA, (b) tRNA, (c) rRNA, (d) all of these.
Briefly describe the function of the following in protein synthesis:
a) rRNA, b) tRNA c) mRNA
(a) Describe the different stages that process of Protein synthesis.
(b) using four examples of antibiotic inhibitors of translation, outlinehow the inhibition occurs.
Chapter 3 Solutions
Fundamentals of Anatomy & Physiology Plus Mastering A&P with eText - Access Card Package (10th Edition) (New A&P Titles by Ric Martini and Judi Nath)
Ch. 3 - List the general functions of the plasma membrane.Ch. 3 - Identify the components of the plasma membrane...Ch. 3 - Which component of the plasma membrane is...Ch. 3 - Which type of integral protein allows water, ions,...Ch. 3 - Prob. 5CPCh. 3 - What are the major differences between cytosol and...Ch. 3 - Prob. 7CPCh. 3 - Prob. 8CPCh. 3 - Explain why certain cells in the ovaries and...Ch. 3 - What does the presence of many mitochondria imply...
Ch. 3 - Describe the contents and structure of the...Ch. 3 - What is a gene?Ch. 3 - Define gene activation.Ch. 3 - Describe transcription and translation.Ch. 3 - What process would be affected by the lack of the...Ch. 3 - What is meant by the term selectively permeable...Ch. 3 - Define diffusion.Ch. 3 - List five factors that influence the diffusion of...Ch. 3 - How would a decrease in the concentration of...Ch. 3 - Define osmosis.Ch. 3 - Some pediatricians recommend using a 10 percent...Ch. 3 - Describe the process of carrier-mediated...Ch. 3 - The concentration of hydrogen ions (H+) in the...Ch. 3 - Describe endocytosis.Ch. 3 - Describe exocytosis.Ch. 3 - What is the process called whereby certain types...Ch. 3 - What is the membrane potential of a cell, and in...Ch. 3 - If the plasma membrane of a cell were freely...Ch. 3 - Give the biological terms for (a) cellular...Ch. 3 - What enzymes must be present for DNA replication...Ch. 3 - Describe interphase, and identify its stages.Ch. 3 - A cell is actively manufacturing enough organelles...Ch. 3 - Define mitosis, and list its four stages.Ch. 3 - What would happen if spindle fibers failed to form...Ch. 3 - Define growth factor, and identify several growth...Ch. 3 - An illness characterized by mutations that disrupt...Ch. 3 - Define metastasis.Ch. 3 - Define cellular differentiation.Ch. 3 - Prob. 1RQCh. 3 - The process that transports solid objects such as...Ch. 3 - Plasma membranes are said to be (a) impermeable,...Ch. 3 - _____ ion concentration is high in extracellular...Ch. 3 - At resting membrane potential, the cytoplasmic...Ch. 3 - The organelle responsible for a variety of...Ch. 3 - The synthesis of a functional polypeptide using...Ch. 3 - Prob. 8RQCh. 3 - The movement of water across a membrane from an...Ch. 3 - Prob. 10RQCh. 3 - List the four basic concepts that make up the cell...Ch. 3 - What are four general functions of the plasma...Ch. 3 - What are the primary functions of membrane...Ch. 3 - By what three major transport mechanisms do...Ch. 3 - List five important factors that influence...Ch. 3 - What are the four major functions of the...Ch. 3 - Diffusion is important in body fluids, because it...Ch. 3 - Microvilli are found (a) mostly in muscle cells,...Ch. 3 - When a cell is placed in a(n) _____ solution, the...Ch. 3 - Suppose that a DNA segment has the following...Ch. 3 - Prob. 21RQCh. 3 - The sodium-potassium exchange pump (a) is an...Ch. 3 - If a cell lacked ribosomes, it would not be able...Ch. 3 - List, in sequence, the phases of the interphase...Ch. 3 - List the stages of mitosis, and briefly describe...Ch. 3 - (a) What is cytokinesis? (b) What is the role of...Ch. 3 - The transport of a certain molecule exhibits the...Ch. 3 - Solutions A and B are separated by a selectively...Ch. 3 - A molecule that blocks the ion channels lining...Ch. 3 - What is the benefit of having some of the cellular...Ch. 3 - List the general functions of the plasma membrane.Ch. 3 - Identify the components of the plasma membrane...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- This protein adduct can hold (tether) a peripheral membrane protein to the cell membrane: A) A fatty Acid B) A charged amino acid. C) A polar amino acid D) A phosphate grouparrow_forward(a) In what important ways do the α helix and β sheet structures differ? (b) How are they similar?arrow_forward16) PROTEIN SYNTHESIS: A) Describe the process of protein synthesis. Be sure to use transcription and translation in your answer (and explain the parts involved in each process) B) Why is RNA transcription a necessary process?arrow_forward
- Which statement below about mRNA is true? A)A gene's promoter sequence is transcribed into mRNA. B)Translation begins at the 5′ end of a molecule of mRNA C)mRNA is complementary to the coding strand of DNA. D)Some regions of mRNA are not translated into amino acids.arrow_forwardd) Name X and state how it functions in a protein synthesis. e) Give three differences between molecules X and Y.arrow_forwardwhich statement about genetic code is not true? A) mRNA is read 3 bases at a time, which are called codons. B) There is one initiator codon that codes for an amino acid. C) Each amino acid is coded for by only one codon. D) There are 3 termination codons that do not code for amino acids. E) Each codon is specific for only one amino acid. An anion has an equilibrium potential of -40 mV. What direction are the chemical and electrical forces acting on the anion at the resting membrane potential (-70 mV)? A) Both the chemical and electrical forces are directed out of the cell. B) The chemical force is directed out of the cell and the electrical force is directed into the cell. C) The chemical force is directed into the cell and the electrical force is directed out of the cell. D) There is insufficient information to answer this question. E) Both the chemical and electrical forces are directed into the cell.arrow_forward
- a) Identify three types of RNA and provide a description of each and the role they play in protein synthesis. (6 marks) b) Use the DNA sequence below to answer the following questions. 3' - TACGAACGAGTGCCCCAAAATT -5' What is the complementary DNA strand? (1 mark) What is the nucleotide sequence of the mRNA strand transcribed from the initial DNA strand? (1 mark) Provide an alternative mRNA sequence with four changes that would translate to the same amino acid sequence. (2 marks) Paragraph I A + v ... Lato (Recom... v 19px ... v Add a File Record Audio Record Video MacBook Pro G Search or type URL #3 2$ & ( 3 4 7 8 9 山訓 < COarrow_forwardSuppose that a DNA segment has the following nucleotide sequence: CTC ATA CGA TTC AAG TTA. Which of the following nucleotide sequences would be found in a complementary mRNA strand? (a) GAG UAU GAU AAC UUG AAU. (b) GAG TAT GCT AAG TTC AAT. (c) GAG UAU GCU AAG UUC AAU. (d) GUG UAU GGA UUG AAC GGU.arrow_forwardSelect the best answer or answers from the choices given: If DNA has a sequence of AAA, then a segment of mRNA synthesized on it will have a sequence of (a) TTT, (b) UUU, (c) GGG, (d) CCC.arrow_forward
- 1) The nucleolus is a cytoplasmic organelle involved in the synthesis of ribosomes (true or false ) 2)DNA is often referred to as supercoiled because it is most commonly found in cells as two strands of inter-wounded DNA (true or false ) 3) translation is a process of synthesizing proteins based on base sequences of mRNA molecule (true or false )arrow_forwardTranslation is the process of ____ and occurs in the ____. a) mRNA assembly, nucleus b) amino acid metabolism, cytoplasm c) assembling polypeptide chains, cytoplasm d) transcript-building, nucleusarrow_forwardDistinguish between DNA and RNA on the basis of following: a) chemically b) functionally c) by location in the cellarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
What is Genomics - Full Length; Author: Genome BC;https://www.youtube.com/watch?v=mmgIClg0Y1k;License: Standard youtube license