Genetics: From Genes to Genomes
6th Edition
ISBN: 9781259700903
Author: Leland Hartwell Dr., Michael L. Goldberg Professor Dr., Janice Fischer, Leroy Hood Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 1, Problem 6P
RNA shares with proteins the ability to fold into complex three-dimensional shapes. As a result, RNA molecules can, like protein molecules, catalyze biochemical reactions (that is, both kinds of molecules can act as enzymes, or biological catalysts). These statements are not true of DNA. Why can some RNA molecules act as enzymes whereas DNA molecules cannot? (Hint: Most RNA molecules consist of a single strand of
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
RNA shares with proteins the ability to fold into complex three-dimensional shapes. As a result, RNA molecules can, like protein molecules, catalyze biochemical reactions (that is, both kinds of molecules can act as enzymes, or biological catalysts). These statements are not true of DNA. Why can some RNA molecules act as enzymes whereas DNA molecules cannot?
Select TRUE or FALSE for each of the following statements:
1. Only one of the three phosphate groups present in each nucleotide precursor remains present in a DNA polymer.
2. Starch and cellulose are alike in that both contain sugars bonded together in identical ways.
3. The coding strand of DNA is complementary in sequence to the corresponding MRNA.
4. Ribosomal RNA (rRNA) is synthesised by ribosomes in the process of translation.
5. Polyribosomes speed up the rate of transcription.
Hydrolysis of the N-glycosyl bond between deoxyribose and a
purine base in DNA creates an apurinic (AP) site. An AP site is
more thermodynamically destabilizing to a DNA molecule
than is a mismatched base pair.
Examine the structure of an AP site.
H₂N
HN
N
O™
-O-P-O-CH₂
Guanine
H₂N
N
HN
Select the chemical consequences that could contribute to DNA instability at AP sites.
H
H
1₂0/
H
fewer hydrogen bonds between the unpaired pyrimidine base and water
disruption of the base-stacking interactions
decreased interaction between the mutated DNA strand and histones
increased ability of the deoxyribose ring to open without the attachment of the purine base
H
H
Guanosine residue
(in DNA)
O™
-O-P-O-CH₂
O
H
H H
O
Apurinic residue
H
OH
H
Chapter 1 Solutions
Genetics: From Genes to Genomes
Ch. 1 - Choose the phrase from the right column that best...Ch. 1 - If one strand of a DNA molecule has the base...Ch. 1 - The size of one copy of the human genome is...Ch. 1 - Indicate whether each of the following words or...Ch. 1 - a. How many different DNA strands composed of 100...Ch. 1 - RNA shares with proteins the ability to fold into...Ch. 1 - The human protein lactate dehydrogenase shown in...Ch. 1 - a. Are the triplets in the genetic code table...Ch. 1 - Why do scientists think that all forms of life on...Ch. 1 - Why would a geneticist study a yeast cell or a...
Ch. 1 - How can a scientist tell if a protein present in...Ch. 1 - Figure 1.6 shows the amino acid sequences of parts...Ch. 1 - Why do scientists think that new genes arise by...Ch. 1 - Explain how the exon/intron structure of genes...Ch. 1 - Mutations in genes that change their pattern of...Ch. 1 - A single zebrafish gene function was inactivated...Ch. 1 - Different mutations in the WDR62 gene that...Ch. 1 - Researchers have successfully used gene therapy to...Ch. 1 - By the time this book is published, it will likely...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- When comparing the structures of RNA and DNA , which of the following statement is True?A-Only RNA contains 3'-deoxyribise rings B-Both RNA and DNA contain 3'-deoxyribise rings C-Only DNA contains 3'- deoxyribise rings D-Neither RNA or DNA contain 3'-deoxyribise ringsarrow_forwardDNA and RNA are chemically very similar but are distinguished, in large part, by the presence of a 2’-OH group in RNA and a 2’-H group in DNA. Why do you suppose that both DNA and RNA have 3’-OH groups and we do not typically find nucleic acids within cells that have 3’-H groups?arrow_forwardWhat are the complementary base pairs in DNA-RNA interactions? Answer format: Base 1(one letter symbol)-Base 2 (one letter symbol, or B-B*(hypothetical N-base) In the lengthening of a polynucleotide chain, which type of nucleotide subunit (name please not the formula) would bond to its 3’ end? How many 3’,5’-phosphodiester linkages are present in a tetranucleotide segment of a nucleic acid?arrow_forward
- Hydrolysis of the N-glycosyl bond between deoxyribose and a purine base in DNA creates an apurinic (AP) site. An AP site is more thermodynamically destabilizing to a DNA molecule than is a mismatched base pair. Examine the structure of an AP site. HN H₂N N 0 Guanine -O-P-O-CH₂O. H₂N H HN H H H Hod H ofo -0- Guanosine residue (in DNA) -0-CH₂ H H H Apurinic residue H OH Harrow_forwardDNA structure depends on base pairing of its four nucleotides, A, C, T, and G. Nucleotide A pairs with T, and nucleotide C pairs with G. This forms a four-letter DNA “alphabet." Because DNA codes for amino acids in sets of three nucleotides, there are 4 cubed (4'), or 64, possible combinations, coding for 20 different amino acids. What is the best explanation for why there is no selective advantage for DNA to have five nucleotides (e.g., A, C, T, G, and E) with C pairing with either G or functionally equivalent E? It would be impossible to form the DNA molecule, because it must have an equal number of Cs and Gs. Because G and E have the same role, there would still be four functional letters of the alphabet. Replication would be inaccurate because sometimes C would bond with G and sometimes C would bond with E. There would be a five-letter alphabet with 125 combinations, which is too numerous. It is impossible because there are not five known nucleotides in the cell.arrow_forwardRNA shares with proteins the ability to fold intocomplex three-dimensional shapes. As a result, RNAmolecules can, like protein molecules, catalyze biochemical reactions (that is, both kinds of moleculescan act as enzymes, or biological catalysts). Thesestatements are not true of DNA. Why can someRNA molecules act as enzymes whereas DNAmolecules cannot? (Hint: Most RNA moleculesconsist of a single strand of nucleotides while mostDNA molecules are double helixes made of twostrands of nucleotides.)arrow_forward
- TRUE OR FALSE a) The 2 chains composing one double helix run in opposite directions; they are antiparallel (one is 5’->3’ and the other 3’->5’). b) DNA molecules can perform their function in replication and transcription as long as the hydrogen bonds between the bases remain intact.arrow_forwardDraw the chemical structure of a dinucleotide composed of A and G. Opposite this structure, draw the dinucleotide composed of T and C in an antiparallel (or upside-down) fashion. Form the possible hydrogen bonds.arrow_forwardThe double helical structure of DNA is intrinsically unstable and easily dissociates to form two separate strands. Why? How does this affect the two key biological functions of chromosomal DNA? What would happen if the DNA helices were too stable?arrow_forward
- Which of the following nucleotides found in DNA is dGTP? Note, hydrogens bound to carbon atoms are not shown.arrow_forwardWhat determines the sequence of nucleotides in the template strand of DNA? (The answer can be very basic don’t need lots of details)arrow_forwardAs you should recall, DNA, when not being actively transcribed, has a double helical structure. This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein. The following is one of the two complimentary strands of DNA: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template strand? ______________________________ Q: Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47: mRNA: ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___- polypeptide chain: ________--________--________--________--________--________--________--________arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Macromolecules | Classes and Functions; Author: 2 Minute Classroom;https://www.youtube.com/watch?v=V5hhrDFo8Vk;License: Standard youtube license