You measure the membrane potential and find that it does not change from time X to time Y. However, you find that current across the membrane has increased by a factor of 4 from time X to time Y. Which of the following most likely happened between time X and Y?      a. 4 times as many ion channels closed on the cell membrane     b. Resistance of the membrane changed to ½     c, Resistance of the membrane changed to ¼   d. not enough information

Q: Please asap. Thank you. A hypothetical Anion has a Nernst potential of -30 mV. At 0 mV, the Anion…

A: In a cell, the transport of substances occurs out and into the cell via the aid of the plasma…

Q: The response of ligand gated ion channels is transient because ___ (can choose more than one…

A: The cellular response is initiated when a ligand binds to its specific receptors. The binding of…

Q: Given these three statement- two of which are truths and one is a lie. Which of the following…

A: A and B are true while statement C is a lie.

Q: Test 6- Comparing the DNA (Gene) Code for Dopamine Active Transport Protein Once dopamine triggers a…

A: Here,  human DATP gene sequence of human is given , i.e :  ATTCCGGATCGATATCGCCGGATATACTCCGGTAATATC

Q: Two pore (2P) domain K+ channels: What is the role of this channel? Is this channel voltage…

A: Potassium ions are pushed through cell membranes through voltage-gated potassium channels.…

Q: 17. Resting membrane potential -T a) must be reversed in order for nerve and muscle to function T b)…

A: The cell is the  basic structural and functional unit of cellular organisms. It is an aqueous…

Q: Calculate the free energy of transport for the movement of potassium by the sodium/potassium pump…

A: The Sodium/Potassium pump is a transmembrane ATPase that is situated on the cytosolic side, in the…

Q: 37.Given an intracellular concentration of 120mM and an extracellular concentration of 15mM,…

A: Hi! Thank you for the questions. As you have posted multiple questions, I will be answering the…

Q: Vm mV Or -10 -2아 -30- -40 50 -60 10min OUABAIN

A: Introduction Ouabain is a toxic plant extract that acts as a cardiac glycoside that blocks the…

Q: false about allosteric feedback inhibition

A: Allosteric feedback inhibition  The final product of a biosynthetic pathway can decrease the…

Q: Define resting membrane potential and describe its electrochemical basis. Briefly discuss changes to…

A: ANSWER:- Define resting film potential and portray its electrochemical basis. RMP - Degree of the…

Q: Hyperkalemia was discussed at length in this module.  If a cell is experiencing hyperkalemia, what…

A: Question-  Hyperkalemia was discussed at length in this module.  If a cell is experiencing…

Q: How is it possible for the GABA activated chloride channel (GABA-A receptor) to switch the direction…

A: In γ-aminobutyric acid type A (GABA) signaling, the interaction of GABA with synaptic GABAA…

Q: Explain neurons as a specialized form of cell signalling that acts long-distance, rapidly, and on…

A: specialised mechanism of cell signalling in neurons When a transmitting neuron fires, an electrical…

Q: A hypothetical anion has a Nernst potential of -100 mV. At resting membrane potential (-70 mV), the…

A: The Nernst potential, also known as the reversal potential of an ion, is the potential difference of…

Q: Focus on the interaction of ATP with the kinase first. Would you say ATP binds on the surface of the…

A: Note: Since the given image does not indicate Mn2+ ions, the third question cannot be answered. ATP…

Q: If the Cl- concentration outside of cells is 10 mM and inside of cells is 10mM, what would the Cl-…

A: In biology, the membrane has a reversal potential or equilibrium potential which possess the ability…

Q: Which of the following is not true in ligand-gated ion channels? a. S4 segment moves in response…

A: Protein channel receptor complex with a binding site for a small molecule. They open their…

Q: Membrane Potential (mV) -70 + 1 3 Time (ms) 1 Na* continues to rush into the cell E Excess…

A: The Na +K + pump is found in cell membrane of neurons as well as in other animal cells. It helps in…

Q: What is LPS (not just what does it stand for)

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: 42.The sodium/calcium exchanger (NCX) transports three sodium into the cell for every one calcium…

A: Active transport is a process of transporting molecules across the cell membranes using ATP.  They…

Q: + + + +, 212 LOGY - BIt | + + + Given the information provided in this question, if 212 is an anion…

A: The cell's interior is usually negative at resting membrane potential. This membrane potential is…

Q: Need answer of this? Explain the role of first aiders with examples.

A: We know that Humans face different challenges in their life. Some of the challenges may lead to…

Q: Q-Slide #6 Add icons to show what CaMKII does to its substrate proteins Me СР2 Ca" CP2 Me Glu СВР…

A: CaM kinases are family of enzymes enriched in nervous tissue that are activated by binding to…

Q: Ion Extracellular Concentration (mM) Intracellular Concentration (mM) Na+ 440 50 K+ 20 400…

A: Introduction : The equilibrium potential of an ion refers to the membrane potential of the neuron at…

Q: Multiple Choice. Imagine a solution containing only water, sodium, and glucose. If a voltage is…

A: Molecule or atoms without any charges are non conductors of electricity. Glucose is a non conductor…

Q: Hyperpolarization-activated cation current (Ih)- When is this channel activated? What is the…

A: Ion channels are integral membrane proteins in nature. They are essentially assembled from different…

Q: Enhancer 4 What should be the normality of 1 L saline water needed to be injected intravenously to a…

A: Osmotic pressure of blood =7.75atm Body temperature =37deggre C Saline water =1L

Q: Transient receptor potential (TRP) channels are ion channels found on animal cells. Some TRP…

A: Answer. The TRP channel is a receptor response that normally presents in around 28 types which are…

Q: How is the cell membrane like a battery?

A: Cell membrane forms the outer most part of animal cells. It also limits the entry and exit of…

Q: Compare the plots of the transport rates for both conditions. What is most likely mechanism of…

A: Serotonin is a neurotransmitter that carries messages in the form of chemicals from one nerve cell…

Q: 12. Fill in the blanks with the best answer from the list below. Answers are used only once, but not…

A: G protein coupled receptors are present on the membrane. It  binds an extracellular signal there by…

Q: What is the effect of membrane potentials on the movement of ions across a cell? use the following…

A: Answer: MEMBRANE POTENTIAL - It is basically the difference in electric potential between the…

Q: Vm Net flow of the Potassium Net flow of the Sodium -90 -70 +80 +64

A: Membrane potential, also known as transmembrane potential or membrane voltage, refers to the…

Q: Intestinal epithelial cells pump glucose into the cell against its concentration gradient using the…

A: Enthalpy and entropy are combined to form the Gibbs free energy. The combination of the system's…

Q: ppose hdt Certain Cells lounu are shown below. The resting membrane potential is -75 mV. Assume that…

A: 1. The layer potential How the resting layer potential is laid out in a neuron Central issue A…

Q: Only a few. Why do only a small number of sodium ions need to flow through the Na+Na* channel to…

A: Sodium channels are made up of integral proteins which helps in the movement of sodium ions across…

Q: Write an equation balancing the electrical potential and chemical potential for 3 Na+ and 1 Ca2+.…

A: The chemical gradient (Δμ) generated from transporting a chemical species from side 1 of the…

Q: Which of the following does not influence (i.e has no impact on) the value of the Nernst potential…

A: Neurons transmit nerve impulses as chemical signals called neurotransmitters or electrical impulses…

Q: Activity: Mix and Match Directions: Match the division of the nervous system in Column A to the…

A: The nervous system in human body is an organ system that coordinates the functioning of all the…

Q: Fil in the blanks  1. A resting muscle fiber or neuron has an internal charge that is…

A: The transmission of impulses caused by various stimuli is done by the neurons present in the human…

Q: At Intestinal epithelial cells pump glucose into the cell against its concentration gradient using…

A: Two questions are asked. I am allowed to answer only 1st question, as per guidelines.  Given : Na+…

Q: P2X and Acid-sensing ion channels

A: Expressed in both the peripheral and central nervous system Neuronal ion-permeable channels play…

Q: WHAT IF? Suppose a mutation caused gated sodiumchannels to remain inactivated longer after an…

A: Movement of Na+ and K+ ions across the membrane generate the action potential, that conduct the…

Q: Intestinal epithelial cells pump glucose into the cell against its concentration gradient using the…

A: Using the given information, Energy released by downhill movement of sodium ions,  Delta G =…

Q: Need help  Ligaments and tendons are tissues whose response varies with time and exhibits rate…

A: Hi dear, here's your answer.   Tendons and ligaments show both non straight and viscoelastic conduct…

Q: What is your estimate for the gNa and for gK?  If you are more comfortable, use

A:

Q: Conditions: [Na+] outside = .3 mM [Na+] inside the presynaptic cell = .01 mM [dopamine] inside =…

A: Since you have asked multiple question, we will solve the first question for you. If you want any…

Q: What types of GPCRs act in nociceptors to induce excitatory signaling?

A: GPCR also called G protein coupled recepter are type of receptor which have seven membrane spanning…

Cell Signaling

It allows cells to perform various cellular activities, coordinate, and interact with other cells. All cells of an organism receive signals from their environments and respond accordingly. Even the unicellular eukaryotes receive signals secreted by other cells and respond. In the case of yeast, mating takes place by signaling between the yeast cells. Communication by cell signaling in a multicellular organism has become a vast and important part of various fields of biology.