You are studying a eukaryotic gene in which translation normally begins at the second AUG in the mRNA (underlined). The sequence surrounding both AUGs is CGGAUGCACAGGACAUCCUACCUACGGAGAUGA.... Predict the effects of the following mutations on the translation of this mRNA. Present the new sequence, highlight the changes in the sequence and consider the best context for translation. a. Change the first and second C to G b. Change the first and second C to G and also change the UAC codon before the second AUG to UAG.

You are studying a eukaryotic gene in which translation normally begins at the second AUG in the mRNA (underlined). The sequence surrounding both AUGs is CGGAUGCACAGGACAUCCUACCUACGGAGAUGA.... Predict the effects of the following mutations on the translation of this mRNA. Present the new sequence, highlight the changes in the sequence and consider the best context for translation. a. Change the first and second C to G b. Change the first and second C to G and also change the UAC codon before the second AUG to UAG.

Name: You are studying a eukaryotic gene in which translation normally begin
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: You are studying a eukaryotic gene in which translation normally begins at the second AUG in the mRNA (underlined). The sequence surrounding both AUGs is CGGAUGCACAGGACAUCCUACCUACGGAGAUGA.... Predict the effects of the following mutations on the tran

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter13: Gene Expression

Section: Chapter Questions

Problem 12TYU

See similar textbooks

Similar questions

Consider the following portion of mRNA produced by the normal order of DNA nucleotides: 5’ – CUU AAA CCA GUU – 3’ a. What is the template DNA sequence that was used to synthesize this portion of mRNA? b. What is the amino acid order produced from this mRNA? c. Write the amino acid sequence if a mutation changes CUU to CAU. Is this likely to affect protein function?
) A normal mRNA that reads 5'- UGCCAUGGUAAUAACACAUGAAGGCCUGAAC-3' was an insertion mutation that changes the sequence to 5'- UGCCAUGGUUAAUAACACAUGAGGCGUGAAC-3'. Translate the original mRNA and the mutated mRNA and explain how insertion mutations can have dramatic effects on proteins. ( Hint; Be sure to find the initiation site).
1. Translation a)Explain the role of ribosomes in the process of protein translation.b. Explain the role of tRNA molecules in protein translation.c. Define the following terms:1. codon 2. anticodon. Explain how a codon is used in the process of translation.
For the following mRNA sequence (reading from left to right) what will be the amino acid sequence following translation? (Use chart provided) AUGCCAGUUGAAUAA A. Pro-Val-Met-Leu-His B. Met-Val-Tyr-Pro C. Met-Pro-Val-Glu D. Correct answer not given E. Met-His-Phe-Ala-Arg
a. In your claim words, depict the contrast between ρ-dependent and ρ-independent end of translation in prokaryotes. b. If you have a given amino acid, can you be able to identify its RNA? Why or why not? c. How does mutation can affect the central dogma and the phenotype?
Which of the following is TRUE in translation? A. Amino acyl TRNA containing one amino acid is attached to the P site B. Amino acids/peptides attached to the amino acyl tRNA at the P site are transferred to amino acids at the A site, followed by translocation. C. Empty TRNAS are immediately released from the ribosomes D. The E site is always empty after translocation to receive incoming empty TRNAS. E. The anticodon binding to the codon is stringent, i.e. there must be complete complementary base-pairing between the bases in the codon and anticodon before translation can proceed.
Consider the mRNA sequence below. Assume that the following mRNA segment has been translated. 5’-UACCGAAUGUCU-3’ Note for letters a and b: Use the three-letter abbreviation of amino acid; separate amino acids with a hyphen: do not include the stop codon. Example: ala-cys-glu a. Using the table of the genetic code, determine the sequence of amino acids. b. If mutation occurs by substitution of the 12th nucleotide with cytidine-5’-monophosphate, what is the resulting amino acid sequence? c. What type of mutation occurred? Choose from same sense, missense and non-sense.
give the amino acids specified by the following bacterial mRNA sequences. a. 5′ –AUGUUUAAAUUUAAAUUUUGA–3′ b. 5′ –AGGGAAAUCAGAUGUAUAUAUAUAUAUGA–3′ c. 5′ –UUUGGAUUGAGUGAAACGAUGGAUGAAAG AUUUCUCGCUUGA–3′ d. 5′ –GUACUAAGGAGGUUGUAUGGGUUAGGGG ACAUCAUUUUGA–3′
DNA from a eukaryotic gene was isolated, denatured, and hybridized to the mRNA transcribed from the gene; the hybridized structure was then observed with an electron microscope. The adjoining diagram shows the structure that was observed. a. Identify and label the exons and introns in this hybridized structure.
For each of the five short mRNA nucleotide sequences given in the table below: 3. Translate the original sequence (for these short sequences start translation at the first nucleotide) 4. Identify (and highlight or underline) the one nucleotide difference between the original (left) and altered (right) sequences 5. For each altered nucleotide sequence give the type of mutation (effect at the DNA/nucleotide level; see #1 above) 6. Translate each changed sequence. Does the mutation result in a change in the amino acid sequence? If so, what is the effect of the mutation on protein structure (amino acid sequence; see #2 above)
Consider the mRNA base sequence 5' ACC CAC 3'. what dipeptide is coded for by this mRNA? * A. Asparagine- Histidine B. Lysine -Serine C. Aspartic Acid - Histidine D. Lysine-Glysine Look at the following sequence, " THE FAT CAT ATE THE CAT" Remove the first "H" and regroup the letters in group of three. What type of mutation? * A. Deletion-Frameshift B. Insertion- frameshift C. Substitution-Deletion D. Substitution-Insertion Which of the following types of RNA is involved in the transcription phase of protein synthesis? * A. rRNA B. tRNA C. hnRNA D. no correct response A tRNA molecule has the anticodon 5' AAG 3', with which mRNA codon will this anticodon interact? * A. 5' AAG 3 B. 5' CUU 3' C. 3' GAA 5'…
Consider the mRNA base sequence 5' ACC CAC 3'. what dipeptide is coded for by this mRNA? * A. Asparagine- Histidine B. Lysine -Serine C. Aspartic Acid - Histidine D. Lysine-Glysine Look at the following sequence, " THE FAT CAT ATE THE CAT" Remove the first "H" and regroup the letters in group of three. What type of mutation? * A. Deletion-Frameshift B. Insertion- frameshift C. Substitution-Deletion D. Substitution-Insertion Which of the following types of RNA is involved in the transcription phase of protein synthesis? * A. rRNA B. tRNA C. hnRNA D. no correct response A tRNA molecule has the anticodon 5' AAG 3', with which mRNA codon will this anticodon interact? * A. 5' AAG 3 B. 5' CUU 3' C. 3' GAA 5'…